ORIGINAL ARTICLE
Differential expression of circulating micro-RNAs in patients with
active and latent tuberculosis
José Yareta
1,2,
Biologist
Marco Galarza
1, Biologist
Silvia Capristano
1, medical technologist with specialty in Clinical Laboratory
Oscar Pellón
1, molecular biologist, Molecular and Celular Biology of Cancer PhD
César Sánchez
1, physician, Sciences master
Jorge Ballon
2, physician, Sciences master
Heinner Guio
1, physician, Doctor in Medical Sciences
1 Laboratorio de Referencia Nacional de
Biotecnología y Biología Molecular, Instituto Nacional de Salud, Lima, Perú.
2 Departamento Académico de Biología,
Universidad Nacional de San Agustín de Arequipa, Arequipa, Perú.
ABSTRACT
Objectives:
To analyze the differential expression of miR-21, miR-29a, miR-99b and miR-155
in serum
Materials and Methods: We used 28 serum samples (9 with active TB, 10 with latent TB and 9 healthy controls) for the analysis of gene expression by RT-qPCR with Primers and TaqMan probes. The differential expression was calculated by the Livak method using a normalizing gene (RNU-48).
Results: Overexpression of
miR-155 was found in people with latent tuberculosis, compared to healthy
controls (0.63 vs. 0.01; p value = 0.032).
Conclusion:
The miR-155 could be considered a biomarker to differentiate latent TB from
active disease. Studies with larger sample sizes are required to corroborate
the findings.
Keywords: Latent Tuberculosis; Tuberculosis; microRNAs; Peru (source: MeSH NLM).
INTRODUCTION
Tuberculosis (TB), one of the top ten killer diseases in the
world, is caused by the Mycobacterium tuberculosis bacillus (Mtb). In 2017, the
World Health Organization (WHO) reported 31,120 TB cases in Peru (1,2).
In addition, 1.7 thousand million worldwide people have latent TB, and
according to Houben and Dodd 20% to 30% of the Peruvian population have latent
TB (3).
The search for new biomarkers, derived from the
pathogen or the host, is focusing on concepts of cellular communication,
represented by the extracellular vesicles called exosomes. The study of
circulating microRNAs contained in these exosomes proposes new diagnostic
methods in different diseases, including infectious diseases (4), so
they can be easily detected in the different types of biofluids in the human
body.
|
KEY MESSAGES |
|
Motivation for the study: The search for a
biomarker that will allow the rapid and reliable diagnosis of latent TB in
Peru.
Main findings: Micro-RNA (miR-155) that would be overexpressed in subjects with a
latent TB diagnosis.
Implications: Since a high percentage of the Peruvian population
is infected with latent TB, an adequate biomarker will help us to diagnose
TB infection in a timely manner before the active disease develops and to
direct treatment or prophylaxis to those who really need it. |
Particularly, at the level of microRNAs
(miRNAs) and proteins, the analysis of dynamic changes in exosome cargo offers
the possibility to study the activation of cellular and immunological signaling
pathways in real time, in order to validate biomarkers that correspond to
symptomatic and asymptomatic stages (5).
Currently, TB diagnostic methods only detect an
active disease, so there are no biomarkers that differentiate latent and active
TB for a more specific diagnosis. For this reason, for some years now, research
has been conducted on the difference in molecules produced by the host
(microRNA) in the context of an infectious disease versus healthy people as a
control, this process is called “differential expression” and is evaluated by
real-time PCR (Polymerase Chain Reaction), considering a normalizing or
reference gene (6,7). These molecules are microRNAs with 18 24
non-coding, endogenously expressed and highly conserved nucleotides, which
regulate the post-transcriptional expression of genes through sub/over
expression of RNAs in a wide range of organisms in both normal physiological
and pathological circumstances.
The deregulation of microRNAs is variable in
infectious diseases, and it depends on the population studied. In this sense,
the study of these microRNAs in TB has been carried out mainly in European and
Asian populations, where diverse microRNAs expressed differentially among
pathologies (8,9).
Technological advances have generated a multitude of platforms for the creation
of microRNA profiles, and an understanding of the strengths and difficulties of
the different approaches can help their effective use (10).
This study evaluates the
differential expression of miR 21, miR-29a, miR-99b and miR-155 microRNAs taken
from patient serum samples in order to find a different miRNA profile in latent
TB in comparison with active TB and healthy controls.
MATERIALS AND
METHODS
Clinical samples and ARN extraction
The clinical samples used were 28 serum samples taken from
patients with active TB diagnosis (n=9), patients with latent TB (n=10) and
healthy controls (n=9) (Table 1). The samples were stored in 2 ml cryovials in
the freezer at -80 °C (Thermo Fisher Scientific Inc.) of the Immunology area of
the National Reference Laboratory of Biotechnology and Molecular Biology of the
National Center of Public Health of the National Institute of Health.
Table 1. Clinical and auxiliary examination
characteristics in patients with latent TB, active TB and healthy controls.

PPD: Mycobacterium tuberculosis Purified Protein Derivative; TB:
Tuberculosis; mm: millimeters; (+) positive test result.
The samples were collected between 2012 and 2016, and
they are part of a study approved by the Research Ethics Committee of the
National Institute of Health, “Study of the immunological characteristics of
latent tuberculosis in the Peruvian population, year 2012-2014” (according to
OGIIT code OI 01-072- 10). Each participant in the study signed an informed
consent form previously approved by the Ethics Committee of the Peruvian
National Institute of Health.
The miRNeasy (Qiagen) kit was used for RNA
extraction from selected sera, and was used according the manufacturer’s
recommendations. Total RNA concentration was quantified using a Nanodrop 8000
(Thermo Fisher) kit. The extracted RNA was stored at - 20 °C in ultra-pure
water free of RNases (11) and processed
immediately by retrotranscription to complementary DNA within 72 hours.
Selection of microRNAs for real-time PCR validation
A search was made for the differentially expressed microRNAs in
previous publications that included different populations, finding mainly works
in European and Asian populations (8,9,12-14).
The selection criteria for microRNAs included: a) microRNAs expressed in TB
patients, b) microRNAs differentially expressed in serum by real time PCR and
c) overexpressed microRNAs in TB patients by the Microarray and Next
generation sequencing platforms. Taking into account these criteria, four
microRNAs were selected from a group of TB-related microRNAs: miR-21, miR-29a,
miR-99b and miR-155 as possible biomarkers for a differential diagnosis between
latent and active TB (9,10,13-16) in samples from the Peruvian population.
Real-time
PCR and differential expression analysis of microRNA
The previously designed primers were hsa-miR-21 (MI0000077:
UAGCUUAUCAGACUGAUGUGA), hsa-miR-29a (MI0000087: UAGCACCAUCUGAAUC- GGUUA),
hsa-miR-99b (MI0000746: UGAGGUAGGUUGUAUAGUU) and hsa-miR-155 (MI0000681:
UUAAUGCUAAUCGUGAUUA-GGGGU) (Applied Biosystem) obtained from the miRbase
database (http://www. mirbase.org/) (17).
The amplification of the microRNAs was performed in two steps: an initial
retrotranscription was performed to obtain the complementary DNA, using the
TaqMan MicroRNA Reverse transcription kit (Applied Biosystem) followed by a
real-time PCR amplification using the (Applied Biosystem) TaqMan Universal PCR
Master Mix II kit. Sample volumes and concentrations followed manufacturer’s
recommendations (18). Retrotranscription was performed using a (Applied
Biosystem) Veriti thermal cycler under the following conditions: 16 °C for 30
minutes, 42 °C for 30 minutes and 85 °C for 5 minutes. The subsequent
amplification was performed in the Rotor Gene Q (Qiagen) thermal cycler under the
following conditions: 95 °C for 10 minutes, 45 cycles of 95 °C for 15 seconds
and 60 °C for 60 seconds. Each sample was run twice and the thermocycler
considered an average Ct of both runs per sample and gene evaluated. RNA RNU48
was used as the reference gene (11,19) to normalize the expression of the genes under
study.
The differential expression
analysis was calculated using the Livak method, which uses the Ct values
(threshold value to discriminate between negative and positive, maximum Ct
considered was 35) (19) of the diseased
and healthy samples to finally be normalized with the reference gene (RNU48).
The median Ct values were used to calculate the relative amount by the ddCt
comparative method. The ddCt values were used to find the differential
expression level or relative quantification normalized by the Livak method or 2
(-ddCt)
method, where dCt diseased samples = (Ct microRNA of interest
– Ct RNU48), dCt healthy samples = (Ct microRNA of
interest – Ct RNU48) and the ddCt = (dCt diseased samples
– dCt healthy samples) and the standardized relative quantification
or differential expression is equal to 2-ddCt or Fold Change (FC, change in the expression
from the control group or healthy samples) (7).
Statistical analysis
MicroRNA
expression levels were analyzed using the non-parametric Kruskal-Wallis test.
It was used to make multiple comparisons between latent TB, active TB and
healthy controls before performing the Mann-Whitney test. The Prism 6
statistical package (GraphPad Software, Inc, CA, USA) was the one used.
RESULTS
Relative quantification of microRNAs using real-time PCR
The results of relative quantification using real time PCR show
different Ct values in each fluorescence curve for miR-21, miR29a, miR-99b and
miR-155 regarding the RNU48 normalizer. Which gave us Ct values lower than 35,
these Ct values were used to find the ddCt and the normalized relative
expression level.
When analyzing the Ct data obtained by real-time PCR,
it was found that the four selected microRNAs were differentially expressed
(without reaching a statistically significant difference when comparing the
groups using the Kruskal-Wallis and Mann-Whitney non-parametric test in
patients with active TB and patients with latent TB compared to healthy
controls).
Data standardization and
analysis
According to the Livak method, the standardized relative
quantification or gene expression for miR-21, miR-29a, miR-99b and miR-155 in
serum samples is represented by the number of times more, expressed in active
TB and latent TB samples versus the control group. The standardized relative
quantification (RQn) of these microRNAs between latent TB and active TB is
represented by the relative median between both pathologies (Table 2).
Table 2. Standardized differential expression
analysis of miR-21, miR-29a, miR-99b and miR-155 in patients with latent TB and
patients with active TB versus healthy controls.
L1-L10: Patients with clinical diagnosis of latent tuberculosis;
A1- A9: Patients with clinical diagnosis of active tuberculosis; ddCt*: Livak
method or expression (fold change);
TB: Tuberculosis.
No statistical differences were found in the miR-99b
gene expression in patients with active TB and latent TB (Figures 1 and 2).
Distribution of expressions from the minimum to the maximum level
of expression in each group and the differences in the medians for each group
of genes.

Figure 1. Standardized relative quantification in ten
patients with latent 44TB and nine patients with active TB versus healthy
controls. Analysis performed by the Livak method.

Figure 2. Differential expression (medians) of
microRNA between latent TB and active TB.
DISCUSSION
For some years now, transcriptomic analyses have been used to
obtain information on how genes are being expressed and how small RNAs regulate
them, among these, the microRNAs. Currently, these small molecules (miRNAs) are
being used as potential components of vaccines, biomarkers for early cancer
diagnosis and predictors of metabolic diseases (20,21). Likewise, the expression
of other groups of small RNAs, whose function was not very clearly known, are
now being considered as disease biomarkers (22).
The findings related to the deregulation of these microRNAs are
varied. Wang et al. showed that miR-21 is
expressed in a differential manner between patients with active TB and patients
with latent TB, thus showing that this microRNA could be used as a biomarker to
differentiate people with latent TB from those with active TB (2.99 FC) (23). In
our research we found an overexpression of miR-21 in active TB samples (2.07
FC), congruent with the work of Wu et al. who
pointed out that miR-21 could be involved in the regulation of the
antimicobacterial response. Wu et al. described
that miR-21 may be induced after BCG vaccination by NF-kB activation. They also
reported that miR-21 may suppress IL-12 production (24) and this may indicate that in patients with
latent TB, miR-21 is also over expressed. Similar findings were reported by
Kleinsteuber et al. who compared miR-21
expression in healthy donors (negative PPD), individuals with latent TB and
patients with active TB; finding higher expression of miR-21 in patients with
latent TB (0.0438 FC) than in the presence of PPD (0.0393 FC) and patients with
active TB (0.0121 FC) (9). However, according to our results, the
miR-21 expression profile in latent TB samples is higher than the one from
control samples. On the other hand, the miR-21 expression profile in latent TB
samples is lesser in the presence of active TB. Therefore, miR-21 could be an
effective strategy that uses Mtb against the host immune response to evade the
defense cells and develop active TB (14), but when comparing the
expression between latent and active TB, there are no significant differences,
so it would not be used as a biomarker to differentiate both pathologies.
On the other hand, Wu et al. reported that the expression profile of miR-155 (3.7 FC) in
the presence of PPD (Mtb-derived protein to detect latent TB by an
antibody-antigen immune response) could be a potential marker for the diagnosis
of TB in the presence of Mtb-specific antigens (25). However, our results show
higher expression of miR-155 in latent TB (0.63 FC) than in active TB (0.01 FC)
with respect to control samples, thus miR-155 could be a possible biomarker of
latent TB. This data is not totally opposite to that of J. Wu et al. since they also found an overexpression of miR-155 in the
presence of PPD. This Mtb protein activates the early immune system, expressing
immune effectors against latent TB as shown by Fu et al. in a recent study, where they state that miR-155 regulates
the adaptive immune response (13).
The immune system, when regulating the Mtb invasion,
does not cause clinical symptoms. Therefore, the infection becomes latent in
the host, thus an overexpression of miR-155 is noted in serum samples. This was
predicted by Kumar et al, where miR-155 is overexpressed in Mtb infected
macrophages as an early immune response against TB infection (26).This
ratifies the results obtained in this study regarding overexpression of miR-155
in serum samples with latent TB (0.63 FC) when compared to active TB (0.01 FC).
Likewise, Wang et al. reported differential
expression of miR-155 between active and latent TB, since miR-155 is
underexpressed in active TB samples (0.51 FC) and overexpressed in latent TB
samples (1.97 FC) (23). On the other hand, Zhou et al. describe that miR155 is underexpressed in active TB samples
taken from children (27); this finding would allow the use of miR-155 as a
biomarker of latent TB in different life stages.
In another study, Wagh et al. highlighted the underexpression of miR-155 in multidrug
resistant TB (MDR-TB) samples, with regard to the control group and patients
with TB under treatment, which shows that TB virulence can be diagnosed by the
underexpression of miR 155 (28). Therefore, the results of our research
suggest that miR-155 could be an effective biomarker for the diagnosis of
latent TB and mark the progression of the disease in its different stages.
The miR-29a expression level found in our study is
high in active and latent TB samples compared to the control group, but it was
more overexpressed in the latent TB samples than in active TB samples. This
result is consistent with the studies by Fu et al. who
found overexpression of miR-29a (11.9 FC), which could differentiate TB
patients from healthy controls (13,29). However, we also observed an overexpression
of miR-29a (1.50 FC) in latent TB with respect to the expression in active TB
samples (1.05 FC), but without finding significant differences in the
expression between latent TB and active TB.
It should be mentioned that one of the limitations for
the present study was the total number of participants, because it was planned
as an exploratory study, so the results obtained should be validated with a
larger number of participants.
On the other hand, studies are currently being
carried out on exosomal proteins that can be used in the routine diagnosis of
some cancers (30) and we consider that the next step for the diagnosis
of infectious diseases will be with the use of microRNAs.
In conclusion, the analysis of the differential expression levels of microRNA in the serum of patients with active TB and latent TB is interesting for the diagnosis of this pathology. Based on the results of this study, we can conclude that significant overexpression of miR-155, in samples with latent TB, could be a possible biomarker for the differentiation between latent and active TB. However, studies with larger numbers of participants are required to corroborate our findings.
REFERENCES
1. GBD Tuberculosis Collaborators. Global, regional, and national
burden of tuberculosis, 1990-2016: results from the
Global Burden of Diseases,
Injuries, and Risk Factors
2016 Study. Lancet Infect Dis. 2018;18(12):1329-1349. doi:10.1016/S1473-3099(18)30625-X
2. World
Health Organization. Global
tuberculosis report 2018 [Internet]. Geneva: WHO;
2018 [citado el 14 de septiembre de 2019]. Disponible en: https://www.who.int/tb/publications/global_report/gtbr2018_main_text_28Feb2019.pdf?ua=1.
3. Houben RM, Dodd PJ. The Global Burden of Latent Tuberculosis Infection: A Re-estimation Using Mathematical Modelling. PLoS Med. 2016;13(10):e1002152. doi: 10.1371/journal.pmed.1002152.
4. Zhang W, Jiang X, Bao
J, Wang Y, Liu H, Tang L. Exosomes in pathogen infections: a bridge to deliver molecules and link functions.
Front Immunol. 2018;9:90. doi: 10.3389/fimmu.2018.00090.
5. Smith VL, Cheng
Y, Bryant BR, Schorey JS. Exosomes
function in antigen presentation during an in vivo Mycobacterium
tuberculosis infection. Sci
Rep. 2017;7:43578. doi: 10.1038/srep43578.
6. Chen C, Ridzon DA, Broomer AJ, Zhou Z, Lee DH, Nguyen JT, et al.
Real-time quantification of micro-RNAs
by stem-loop RT-PCR. Nucleic Acids Res. 2005;33(20):e179. doi:
10.1093/nar/gni178.
7. Schmittgen
TD, Livak KJ. Analyzing
real-time PCR data by the comparative C(T) method. Nat Protoc.
2008;3(6):1101-8. doi: 10.1038/nprot.2008.73.
8. Correia
CN, Nalpas NC, McLoughlin
KE, Browne JA, Gordon SV, MacHugh
DE, et al. Circulating microRNAs
as Potential Biomarkers of Infectious Disease. Front Immunol. 2017;8:118. doi: 10.3389/fimmu.2017.00118.
9. Kleinsteuber
K, Heesch K, Schattling S, Kohns M, Sander-Julch C, Walzl G, et al. Decreased expression of miR-21, miR-26a, miR-29a, and miR-142-3p in CD4(+) T cells and peripheral blood from tuberculosis patients. PloS One. 2013;8(4):e61609.
doi:
10.1371/journal.pone.0061609.
10. Pritchard
CC, Cheng HH, Tewari M. MicroRNA profiling: approaches and considerations. Nat Rev Genet.
2012;13(5):358-69. doi: 10.1038/nrg3198.
11. Yareta Yareta
JL. Validación de un perfil de microARNs para el
diagnóstico diferencial de tuberculosis latente y tuberculosis activa 2018
[Tesis]. Arequipa: Universidad Nacional San Agustín de Arequipa; 2018.
Disponible en: http://repositorio.unsa.edu.pe/bitstream/handle/UNSA/4795/BIyayajl.pdf?sequence=1&isAllowed=y.
12. Abd-El-Fattah AA, Sadik NA, Shaker OG, Aboulftouh ML. Differential microRNAs expression in serum of patients with lung
cancer, pulmonary
tuberculosis, and pneumonia. Cell
Biochem Biophys. 2013;67(3):875-84. doi:
10.1007/s12013-013-9575-y.
13. Fu Y, Yi
Z, Wu X, Li J, Xu F. Circulating microRNAs in patients with active pulmonary tuberculosis. J Clin Microbiol. 2011;49(12):4246-51. doi: 10.1128/ JCM.05459-11.
14. Harapan
H, Fitra F, Ichsan I, Mulyadi M, Miotto P, Hasan NA, et
al. The roles of microRNAs
on tuberculosis infection: meaning or myth?. Tuberculosis (Edinb). 2013;93(6):596-605. doi:
10.1016/j.tube.2013.08.004.
15. Huang
J, Jiao J, Xu W, Zhao H, Zhang C, Shi Y, et al.
MiR-155 is upregulated in patients with active tuberculosis
and inhibits apoptosis of monocytes
by targeting FOXO3. Mol Med Rep. 2015;12(5):7102-8. doi: 10.3892/mmr.2015.4250.
16. Mashima
R. Physiological roles of miR-155. Immunology. 2015;145(3):323-33. doi: 10.1111/imm.12468.
17. Kozomara
A, Griffiths-Jones S. miRBase:
annotating high confidence microRNAs using deep sequencing
data. Nucleic Acids Res.
2014;42(Database issue):D68-73. doi:
10.1093/nar/gkt1181.
18. Biosystems
A. TaqMan® Universal Master Mix
II. Protocol: Life
Technologies Corporation [Internet] thermoFisher scientific; 2010
[citado el 20 de septiembre del 2019]. Disponible en: https://assets.thermofisher.com/TFSAssets/LSG/manuals/cms_069368.pdf.
19. Miotto
P, Mwangoka G, Valente IC, Norbis
L, Sotgiu G, Bosu R, et
al. miRNA signatures in sera of patients with active pulmonary tuberculosis. PloS One. 2013;8(11):e80149. doi: 10.1371/journal.pone.0080149.
20. Chakraborty
C, George Priya Doss C, Bandyopadhyay S. miRNAs in insulin resistance and diabetes-associated pancreatic cancer: the ‘minute and miracle’ molecule moving as a monitor in the ‘genomic galaxy’. Curr Drug Targets. 2013;14(10):1110-7. doi:
10.2174/13894501113149990182.
21. Munagala
R, Aqil F, Gupta RC. Exosomal miRNAs as biomarkers of recurrent lung cancer. Tumour
biol. 2016;37(8):10703-14. doi: 10.1007/s13277-016-4939-8.
22. Qian
Z, Liu H, Li M, Shi J, Li
N, Zhang Y, et al. Potential Diagnostic Power of Blood Circular RNA Expression in
Active Pulmonary Tuberculosis. EBioMedicine.
2018;27:18-26. Doi: 10.1016/j.ebiom.2017.12.007.
23. Wang C, Yang S, Sun G, Tang X, Lu S, Neyrolles O, et al. Comparative
miRNA expression profiles in individuals with latent and active
tuberculosis. PloS One.
2011;6(10):e25832. Doi: 10.1371/journal.pone.0025832.
24. Wu
Z, Lu H, Sheng J, Li L. Inductive
microRNA-21 impairs anti-mycobacterial
responses by targeting
IL-12 and Bcl-2. FEBS letters. 2012;586(16):2459-67.
doi:
10.1016/j.febslet.2012.06.004.
25. Wu
J, Lu C, Diao N, Zhang S, Wang S, Wang F, et al.
Analysis of microRNA expression profiling identifies miR-155 and miR-155* as potential
diagnostic markers for active tuberculosis: a preliminary
study. Hum immunol. 2012;73(1):31-7. doi: 10.1016/j.humimm.2011.10.003.
26. Kumar
R, Halder P, Sahu SK, Kumar M, Kumari M, Jana K, et
al. Identification of a novel role of
ESAT-6-dependent miR-155 induction during infection of macrophages with Mycobacterium tuberculosis. Cell Microbiol. 2012;14(10):1620-31. doi:
10.1111/j.1462-5822.2012.01827.x.
27. Zhou
M, Yu G, Yang X, Zhu C,
Zhang Z, Zhan X. Circulating
microRNAs as biomarkers for the early
diagnosis of childhood tuberculosis infection. Mol Med Rep. 2016;13(6):4620-6. doi:
10.3892/mmr.2016.5097.
28. Wagh
V, Urhekar A, Modi D. Levels of microRNA miR-16 and
miR-155 are altered in serum
of patients with
tuberculosis and associate with
responses to therapy. Tuberculosis (Edinb). 2017;102:24-30. doi: 10.1016/j.tube.2016.10.007.
29. Fu Y, Yi
Z, Li J, Li R. Deregulated microRNAs
in CD4+ T cells from individuals with latent tuberculosis versus active tuberculosis. J Cell Mol Med. 2014;18(3):503-13. doi:
10.1111/jcmm.12205.
30. Zhang W, Ou X, Wu X. Proteomics
profiling of plasma exosomes
in epithelial ovarian cancer: A potential role in the coagulation cascade, diagnosis and prognosis. Int
J Oncol. 2019;54(5):1719-33.
doi: 10.3892/ijo.2019.4742.
Funding:
National Health Institute of Peru.
Citation:
Yareta J, Galarza M, Capristano S, Pellón O, Ballon J, Guio H.
Differential expression of circulating micro-RNAS in patients with active and
latent tuberculosis. Rev Peru Med Exp Salud Publica.
2020;37(1): 51-6. Doi:
https://doi.org/10.17843/rpmesp.2020.371.4468.
Correspondence to:
Heinner Guio Chunga
; Av. Defensores del Morro 2268, Chorrillos, Lima;
heinnerguio@gmail.com.
Conflicts of interest:
All authors have none to declare.
Received:
16/04/2019
Approved:
29/01/2020
Online:
23/03/2020