Glioblastoma: Análisis molecular y sus implicancias clínicas

Artículo de Revisión

Glioblastoma: Análisis molecular y sus implicancias clínicas

Glioblastoma: Molecular analysis and its clinical implications

 

Carlos A Castañeda1,a, Sandro Casavilca1,b, Enrique Orrego1,c, Pamela García-Corrochano1,d, Pedro Deza1,e, Hugo Heinike1,e, Miluska Castillo1,f, Carolina Belmar-Lopez1,g, Luis Ojeda1,h

1 Instituto Nacional de Enfermedades Neoplásicas. Lima, Perú.

a Oncólogo clínico, magíster en Genética y Biología Celular, magíster en Oncología Avanzada; b médico patólogo; c neurocirujano, doctor en medicina; d médico cirujano; e neurocirujano; f toxicóloga; g PhD en Ciencias Biomédicas y Biotecnologicas; h neurocirujano, magíster en Medicina.


RESUMEN

El glioblastoma multiforme (GB) es el tumor cerebral primario del sistema nervioso central (SNC) más frecuente y más letal en la edad adulta. La evidencia epidemiológica indica que su incidencia es menor en la raza hispana. El tratamiento quirúrgico es la opción terapéutica preferente. Recientemente se han introducido nuevas estrategias que incrementan el volumen de resección. El uso de quimioterapia y radioterapia concurrentes mejora la supervivencia de los pacientes, aunque se asocia a toxicidad. La mejora en la comprensión de la biología molecular del GB ha permitido la identificación de biomarcadores predictivos de respuesta terapéutica y pronóstico, así como la identificación de dianas terapéuticas que han permitido el desarrollo de nuevas estrategias en el tratamiento de estos tumores. Entre los biomarcadores actualmente disponibles se encuentran la codelección 1p/19q, la mutación de IDH y la metilación del promotor O6- metilguanina DNA-metiltransferasa. La identificación de dianas terapéuticas permite el desarrollo de nuevas drogas y su evaluación posterior en ensayos clínicos, aunque ninguna de ellas ha sido validada prospectivamente en ensayos clínicos de fase III.

Palabras clave: Glioblastoma; Epidemiología; Factores de riesgo (fuente: DeCS BIREME).


ABSTRACT

Glioblastoma (GB) is the most common and most lethal primary brain tumor. Epidemiologic information indicate that its incidence is lower in Hispanic race. Surgery is the only curative strategy and has recently introduced new strategies that increase resection rates. The use of concurrent chemotherapy with radiotherapy improves survival of patients but is associated with toxicity. Improved understanding of molecular biology of GB allows the identification of predictive biomarkers of response and prognosis as well as therapeutic targets for the development of new therapeutic strategies. Among biomarkers are currently available 1p /19q codeletion, IDH mutation and O6-methylguanine DNAmethyltransferase promoter methylation. The identification therapeutic targets enables the development of new drugs and their evaluation in clinical trials, but none has been prospectively validated in phase III clinical trials.

Key words: Glioblastoma; Epidemiology; Risk factors (source: MeSH NLM).


INTRODUCCIÓN

El glioblastoma (GB) es el tumor maligno primario del sistema nervioso central (SNC) más común en adultos (supone más del 50%) y se asocia invariablemente a un mal pronóstico. Solo el 33% de los pacientes sobrevive al año y el 5% de los pacientes llegan a vivir más de 5 años tras el diagnóstico(1, 2) .La Organización Mundial de la Salud (OMS) clasifica los gliomas fundamentalmente por criterios histopatológicos en: astrocitomas, oligodendrogliomas, oligoastrocitomas y ependimomas. Además, establece una gradación relacionada con el pronóstico de la enfermedad que identifica a los de alto grado como astrocitomas de grado III (astrocitoma anaplásico) y grado IV (GB) (1).

Los GB pueden comprometer cualquier estructura neuroanatómica, pero en adultos es más común en los hemisferios cerebrales, mientras que en los niños lo es en la fosa posterior. Su crecimiento infiltrativo es extremadamente rápido. Histológicamente está compuesto de células de gran variabilidad morfológica, algunas bizarras, pleomórficas y multinucleadas; con actividad mitótica elevada; proliferación microvascular; severa y característica hiperplasia endotelial; microtrombos intravasculares, y necrosis extensas de carácter isquémico o en forma de pseudoempalizadas. La denominación multiforme se debe a la gran heterogeneidad que lo caracteriza con variados patrones y rasgos citológicos. En general, muestran focos bien diferenciados que alternan con otros pobremente diferenciados. Tradicionalmente se han clasificado en dos subtipos morfológicamente idénticos: primarios (GB1) y secundarios (GB2).

Los GB1 representan la mayoría, aparecen sin que existan lesiones precedentes y es más frecuente en edad avanzada (edad media de 60 años). La evolución es breve debido al rápido crecimiento tumoral. Los GB2 representan menos del 10% de los GB, surgen como progresión de astrocitomas de bajo grado (astrocitoma difuso o astrocitoma anaplásico) y afectan a pacientes jovenes. Su evolución es más lenta, y la sobrevida media es significativamente superior debido a la menor edad del debut y al crecimiento tumoral más lento Ambas entidades constituyen enfermedades distintas que evolucionan a través de vías moleculares diferentes.

La OMS incluye al GB de células gigantes y al gliosarcoma dentro de la denominación GB (ICD-0 9440/3), como variedades con algunos rasgos característicos. Adicionalmente, se han descrito entidades con características propias que se encuentran en actual revisión por la OMS. El GB de células pequeñas se caracteriza por una predominio citológico de elementos pequeños con alto cociente núcleo/ citoplasma y elevado índice de proliferación celular, corresponde al 10% del total de GB, que se asocia con un peor pronóstico. El GB con componente tipo tumor neuroectodérmico primitivo (PNET) es una entidad infrecuente, más común en niños y adultos jóvenes, probablemente se asocia con un pronóstico favorable, y se caracteriza por expresión proteica CD56- positivo y vimentina- negativo. El GB con componente oligodendroglial es también una entidad infrecuente con un pronóstico aún desconocido (1,3,4) .

Adicionalmente, el perfil genómico integrado del GB desarrollado con los estudios de la red de investigación de The Cancer Genome Atlas (TCGA) ha revelado varios subtipos moleculares, Estos subtipos se definen por sus alteraciones más importantes en la expresión génica, y se asocian con mutaciones específicas y alteraciones del número de copias. Se reconocen los siguientes subtipos de GB: tipo clásico, tipo mesenquimal, tipo proneural y tipo neural (1,3-6) (Figura 1).

El pobre pronóstico asociado con esta neoplasia la convierte en un problema de salud pública. El conocimiento de las bases biológicas y moleculares de la enfermedad es crucial para la mejor comprensión de esta entidad, manejo diario de los pacientes y para el desarrollo de estrategias de tratamiento más eficaces. Existe escasa información sobre esta enfermedad y su manejo en población latina. A continuación revisaremos los nuevos conocimientos que se han desarrollado en GB y el manejo actual de esta neoplasia.

EPIDEMIOLOGÍA

Globocan 2012 encuentra que la incidencia de GB es aproximadamente de 3,8 casos por cada 100 mil habitantes al año, lo que se traduce en cerca de 240 mil casos durante este periodo (7). Estudios epidemiológicos encuentran diferencias en la incidencia de GB según la etnia/raza de la población y diversos estudios sugieren que la incidencia es menor en población latina que en población caucásica. Estas diferencias pueden deberse a desigualdades en la frecuencia de alelos de susceptibilidad a desarrollar GB descritos para diferentes etnias/razas (8). El Registro de Cáncer de Lima Metropolitana 2004-2005 encuentra 1146 casos nuevos de tumores del encéfalo y sistema nervioso (aunque con confirmación histológica de solo 58%), con una tasa de incidencia estandarizada de 6,9-7 por 100 000, lo que representa el 3,8% de todas las neoplasias malignas. En un trabajo de investigación original que presentamos en este mismo número encontramos que se diagnostican aproximadamente 40 casos nuevos de GB al año en el Instituto de Enfermedades neoplásicas (INEN, institución que atiende al 40% de la población de cáncer de Perú).

FACTORES DE RIESGO

La carcinogénesis representa un proceso de múltiples pasos complejos y se asocia con factores biológicos, físicos, químicos y genéticos. La Agencia Internacional para la Investigación del Cáncer (con sus siglas IARC, en inglés) ha evaluado más de 900 posibles agentes carcinogénicos, incluidas sustancias químicas, mezclas complejas, agentes ocupacionales e infecciosos, pero solo nueve de estas exposiciones se acompañan de informes sobre posibles asociaciones con tumores del SNC en seres humanos (berilio, epiclorhidrina, clordano, heptacloro, metil-tiouracilo, propiltiouracilo, plomo, sulfato de diisopropilo y diclorometano). Varios otros productos químicos aumentaron la incidencia de tumores cerebrales (gliomas) en animales de experimentación, pero sin pruebas concomitantes en humanos (aflatoxina B1, sulfato de dietilo, acrilamida, etilnitrosourea, metilnitrosourea, clorhidrato de procarbazina, metanosulfonato de metilo, sulfato de dimetilo, glicidol, dacarbazina, 1,3-propano sultona, acrilonitrilo).

Las enfermedades infecciosas causadas por virus, bacterias y parásitos, se conocen también como estados asociados o causales, y pueden contribuir a la carcinogénesis cerebral. Cofactores adicionales, tales como la inmunidad sistémica y la inflamación crónica, cumplen un papel importante en este proceso. El análisis de citomegalovirus humano (HCMV) en tejido tumoral y sangre periférica de pacientes con GB vs donantes normales (sanguíneos y quirúrgicos), encontró que más del 90% de muestras de tejido tumoral y 80% de muestras de sangre están asociados con el ADN de HCMV, mientras que los donantes normales no mostraron virus detectable, Estos resultados confirman la asociación de HCMV con GB, y sugieren una reactivación ya sea sistémica del virus en pacientes con GB o derramamiento de ADN viral a partir de células tumorales infectadas en la periferia (9).

Algunos estudios apuntan que determinadas ocupaciones se asociarían a mayor riesgo de padecer un glioma, tales como el uso de plásticos y productos de caucho. Aunque débil, la exposición ocupacional a cloruro de vinilo puede llevar a desarrollar GB entre los trabajadores con un periodo de exposición media de 21 años (10). Navas et al. refieren este mismo resultado en la exposición ocupacional a arsénico, mercurio y productos derivados del petróleo (11), mientras que Cocco et al. relacionan los niveles de plomo con mayor riesgo de desarrollar tumores cerebrales en hombres de raza blanca (OR=2,1, IC 95%: 1,1-4,0) (12). Una revisión reciente sugiere que los hidrocarburos aromáticos policíclicos (HAP) y los insecticidas no-arsenicales pueden comportarse como posibles carcinógenos ocupacionales de tumores cerebrales (13).

Por otra parte, varios estudios sugieren que la ocupación de los padres puede influir en el desarrollo de gliomas pediátricos. En un estudio de casos y controles, los padres que trabajaban en la industria química tenían mayor riesgo de tener hijos con tumores astrogliales (14). Un estudio de casos y controles realizado en siete países encontró un aumento en el riesgo asociado con el trabajo agrícola para todos los tumores cerebrales infantiles combinados (OR=1,3; IC 95%: 1,1-1,6) y para los tumores gliales (OR=1,4, IC 95%: 1,1-1,7) (15). También se ha asociado la ocupación de padres con los vehículos de motor a mayor riesgo de sufrir tumores cerebrales infantiles en general y astrogliales. Por lo tanto, estos estudios sugieren, aunque no prueban, una relación causal entre la ocupación de los padres y de la incidencia de tumores del SNC en su descendencia.

Gran interés se ha dirigido a un posible vínculo entre el uso de teléfonos celulares y los tumores cerebrales, pero ya que su uso generalizado es de poco más de una década ha habido pocas oportunidades para examinar los efectos en la salud a largo plazo. Los teléfonos celulares operan a frecuencias de radio, una forma de energía electromagnética situada en el espectro entre las ondas de radio FM y las ondas utilizadas en hornos de microondas, radares y estaciones de satélite (16). Un reciente metaanálisis evaluó la asociación basada en la publicación de Hardell et al. y del Interphone Study Group, encontrando cierta vinculación para gliomas del lóbulo temporal tras un periodo de latencia de al menos 10 años (OR=1,71; IC 95%: 1,04-2,81) y una asociación para uso ipsilateral de celular de al menos 1640 horas (OR=2,29, IC 95%: 1,56-3,37) (17). Así, la IARC clasificó los campos electromagnéticos de radiofrecuencia de teléfonos móviles y de otros dispositivos que emitan campos electromagnéticos no ionizantes similares como posibles carcinógenos humanos en mayo del 2011 (Grupo 2B) (18).

BASES Y SUBCLASES MOLECULARES

La alteración más frecuente identificada en GB es la pérdida de heterogocidad en 10q, región que contiene genes asociados a control del ciclo celular y reparación de ADN como PTEN, DMBT1, FGFR2 y MGMT. La frecuencia de alteraciones genéticas encontradas en GB1 difiere de la encontrada en GB2, sin embargo, ninguna de estas es lo suficientemente específica (1,5) .

El desarrollo de técnicas de análisis masivo de genes ha identificado tres rutas frecuentemente alteradas en esta neoplasia: la ruta TP53 (TP53, MDM2, MDM4) que afecta al 87% de los tumores, la ruta RB1 (RB1, CD4, CDKN2A), que afecta al 78%, y la ruta RTK/PI3K/PTEN (PI3KCA, PIK3R1, PTEN, IRS1, MET, NF1, EGFR, PDGFR) que afecta al 88% de los pacientes con GB. Las mutaciones afectan exclusivamente a uno de los miembros de cada ruta en la mayoría de los casos, lo que sugiere que estas son funcionalmente equivalentes para la génesis tumoral (5,19-23).

La amplificación del gen EGFR promueve el crecimiento celular, la migración y la sobrevivencia celular. Se encuentra en 40% de los GB (predominantemente en los GB1) y es más frecuente en casos de adultos que en pediátricos. La mitad de los casos de amplificación de EGFR contienen una variante truncada del gen que codifica una proteína que carece de dominio extracelular y que se mantiene constitutivamente activa (EGFRvIII). La amplificación EGFR es mutuamente excluyente de mutación TP53. A pesar de los diversos estudios realizados, no existe consenso sobre el valor pronóstico de la amplificación de este gen (5,23). La amplificación EGFR y su variante EGFR-vIII, son alteraciones frecuentes en el GB de células pequeñas (3).

El gen TP53 codifica la proteína p53 que actúa como factor de transcripción y se une a los promotores de genes relacionados a reparación de ADN. Alrededor del 65% de los GB2 presentan mutaciones en TP53 y más de la mitad se encuentran en los codones 248 y 273. Solo el 28% de los GB1 presentan mutaciones TP53 y no se encuentran restringidas a exones específicos. El gen del represor de TP53, MDM2, está amplificado en el 10% de los GB1 e infrecuentemente en GB2 (5,23).

El gen RB1 (gen del retinoblastoma) controla la transición G1- S en el ciclo celular. La proteína rb1 es fosforilada por CDK4 y la proteína encargada de inhibir esta ciclina es p16. La pérdida de p16, amplificación de CDK4 y metilación del promotor RB1 han sido descritas en GB (5,24).

Una de las alteraciones recientemente descritas es la mutación en el dominio de unión al sustrato de la enzima isocitrato deshidrogenasa NADPH dependiente (IDH) tipo 1 y 2 que participa en la conversión de isocitrato a alfa-cetoglutarato en el proceso de producción de NADPH. Estas mutaciones producen alteraciones epigenéticas y aumentan la expresión de genes que controlan la diferenciación y proliferación celular. Mutaciones de IDH son frecuentes en gliomas grado II y III, y en GB2, mientras que están ausentes en los astrocitomas pilocíticos (grado I), GB1 y ependimomas. La adquisición de esta mutación por parte de la célula precursora parece ser temprana en la gliomagénesis (23-27).

Verhaak et al. (TCGA) analizaron perfiles de expresión génica en 200 GB e identificaron 840 genes que les permitieron establecer cuatro subtipos moleculares de GB, que posteriormente fueron confirmados mediante diferentes estudios con cultivos celulares, modelos animales y muestras tumorales humanas: proneural, neural, clásico y mesenquimal.

Proneural: es el subtipo que más se asemeja a un oligodendrocito y es dominado por la activación de la vía de PDGR. Presenta, además, mutaciones en IDH1 y en TP53. Afecta a pacientes más jóvenes, presenta una mejor supervivencia y se asocia a GB secundarios. Neural: es el que más se asemeja a una neurona madura y no tiene una vía dominante en su biología. Tiene marcadores neuronales como NEFL, GABRA1, SYT1 y SLC12A5, y algunos sugieren que no es un subgrupo propio sino una mezcla de alguno y de tejido cerebral normal. Clásico: este subtipo y el mesenquimal son los que más se asemejan a los astrocitos y está dominado por amplificación y activación de la mutación activadora de EGFR. Además, presenta alteraciones típicas de los GB como ganancia del cromosoma 7, amplificación y/o mutación de EGFR, pérdida del cromosoma 10, deleción de CDKN2A y ausencia del resto de alteraciones (ej. TP53, IDH1, etc.). Mesenquimal: es dominado por perdida de NF1. Además, presenta sobreexpresión de marcadores de células mesenquimales, CHI3L1 y MET, y por deleción de NF1 (28,29).

Sin embargo, los tipos no son homogéneos y muchos tumores no encajan exactamente en alguno de ellos pudiendo estar compuestos de varias subpoblaciones molecularmente distintas. Así, dos trabajos publicados recientemente describen subpoblaciones celulares distintas dentro del mismo tumor que expresan niveles diferentes de receptores tirosina kinasa (EGFR, PDGFRA y MET) (30,31).

Recientemente, Brennan et al. (TCGA) realizaron un análisis genómico, epigenómico, transcriptómico y proteómico en más de 500 casos de GB, e identificaron distintas firmas de expresión de oncogenes y mutaciones que impactan en la sobrevida de los pacientes y pueden predecir respuesta a terapias blanco: encontraron que el 40% de los tumores tuvieron, al menos, una mutacion no- sinónima entre los genes modificadores de cromatina. La mayoría de GB tuvieron rearreglos estructurales y se encontró una alta frecuencia de las variantes estruturales en el brazo q del cromosoma 12 (región que contiene los genes MDM2 y CDK4). Encontraron, ademas, que el pronóstico favorable del subtipo proneural está asociado al fenotipo G- CIMP, y que la metilación del promotor MGMT se asocia con un pronóstico favorable solo en el sutipo clásico. El análisis proteómico encuentra que la expresión de estas no se correlaciona linearmente con la expresión de genes (32).

Así mismo, Sturm et al. evaluaron mas de 130 muestras de GB a traves de análisis basado en epigenética, número de copias y expresión de genes. Ellos encuentran seis subgrupos epigenéticos de GB de acuerdo al patrón de metilación de DNA global que albergan distintos puntos calientes de mutaciones, alteraciones en el número de copias de DNA y patrones transcriptómicos. Dos de estos subgrupos presentan mutaciones recurrentes de H3F3A que afectan a aminoácidos críticos (K27 y G34) de la histona H3.3. Cada una de estas mutaciones define un subgrupo de GB con predilección por compartimientos anatómicos separados, con un patrón de metilación global distinto, y con capacidad de regular en forma específica los factores de transcripción OLIG1, OLIG2 y FOXG1. Un tercer subgrupo presenta mutaciones IDH1 y ausencia de las mutaciones previamente mencionadas (H3F3A). Las tres mutaciones previamente descritas se presentaron en población pediátrica. Identifica también tres subgrupos epigenéticos adicionales en adultos con GB (33).

Noushmehr et al. (TCGA) evaluaron las alteraciones en metilación de DNA promotor en 272 tumores GB y encontraron que un subgrupo específico de muestras presentaban hipermetilación en un número mayor de focos, y lo denominaron fenotipo metilador de islas CpG en gliomas (G-CIMP). Los tumores G-CIMP pertenecen al subgrupo proneural, son más prevalentes entre los gliomas de bajo grado, tienen distintas alteraciones en el número de copias, y están asociados con mutaciones somáticas de IDH1. Los pacientes con tumores G-CIMP son más jóvenes y tienen una mayor sobrevida (34).

Diversos grupos describen que la expresión proteica de algunos compuestos como IDH1-2 evaluada mediante inmunohistoquímica tiene un valor pronóstico similar al de la detección de mutaciones en genes. Se ha propuesto que la subtipificación de gliomas mediante firmas de combinación de proteínas como EGFR, CD44, MERTK, p53 y OLIG2 puede permitir la identificación de los subtipos moleculares previamente descritos. El Departamento de Patología del INEN ha incluido recientemente la evaluación de la expresión de las proteínas p53, Olig 2 e IDH-1 en el análisis rutinario de las muestras tumorales de GB que se obtienen, con la finalidad de mejorar la identificación del pronóstico e incrementar los conocimientos de esta enfermedad en nuestra población (35).

RESECCIÓN QUIRÚRGICA: PRIMERA OPCIÓN

El tratamiento principal de los GB y de los astrocitomas anaplásicos ha sido, y continúa siendo, la mayor resección quirúrgica posible del tumor documentada mediante RMN dentro de las 72 horas de la cirugía. La cirugía guiada por fluoresceína sódica (FLS-Na) es una técnica quirúrgica en la que se administra una sustancia intravenosa capaz de penetrar en el área tumoral y en el área dañada de la barrera hemato-encefálica permitiendo así una mejor identificación de las estructuras y un mayor volumen de resección tumoral o la posibilidad de que esta sea completa, según encontramos en un trabajo original del INEN. Recientemente se ha incorporado el microscopio OPMI Pentero 900-Zeiss al área de Neurocirugía del Instituto, este equipo permite reducir la cantidad de FLS-Na inyectada y realizar una cirugía guiada por imágenes con la inyección de datos Multivisión, así como una visualización digital integrada con cámara de alta definición HD.

TRATAMIENTO ADYUVANTE

El tratamiento adyuvante con radioterapia asociado a quimioterapia, basada en compuestos alquilantes (agentes que transfieren grupos alquil a las bases de guanina, dañan el DNA y causan muerte celular) como la carmustina (BCNU) o la temozolomida (TMZ) han demostrado que pueden incrementar la supervivencia. Stupp et al. Compararon en un ensayo clínico randomizado fase III multicéntrico el tratamiento de radioterapia sola con el de radioterapia asociada a temozolomida en 573 pacientes de hasta 70 años, afectados de GB y buen estado (ECOG hasta 2) y encontraron un incremento en la supervivencia global de 10,9 a 27,2% a los 2 años y de 1,9 a 9,8% a los 5 años (p<0,001) (36). Así, este segundo tratamiento fue aprobado por las agencias internacionales, incorporando a las guías de consenso para el manejo de los pacientes (como NCCN) y es el que se utiliza en la práctica rutinaria del Instituto.

Algunos estudios han evaluado otras rutas de liberación de quimioterapia. Así, la administración de BCNU utilizando un polímero biodegradable (wafer) localizado intraoperatoriamente, demostró una mejoría significativa en la sobrevida de pacientes con gliomas malignos (13,9 vs 11,6 semanas). Beneficio que se mantuvo por 2 a 3 años tras el implante (37).

El tratamiento con inhibidores de angiogénesis como el anticuerpo monoclonal dirigido contra VEGF fue aprobado en 2009 para el tratamiento de GB recurrentes tras encontrarse altas tasas de respuesta de supervivencia libre de progresión en tres estudios fase II (38-40). Sin embargo, dos estudios recientemente publicados que evalúan el agregar bevacizumab al tratamiento estándar de radioterapia asociada a temozolomida (AVAglio y RTOG-0825) concluyen que a pesar de lograr un incremento en la sobrevida libre de progresión de 3- 4 meses, no se encontró beneficio en la sobrevida global y los pacientes presentaron algunas complicaciones secundarias, especialmente de tipo vascular (41,42).

Finalmente, Hofland et al. compararon la adición de bevacizumab a temozolomida o irinotecan por 8 ciclos junto a radioterapia, tras la resección quirúrgica en 63 pacientes y encontraron tasas de supervivencia de 32 y 23%; y periodos libres de progresión de la enfermedad de 7,7 y 7,3 meses, respectivamente (43).

La información obtenida en estudios preclínicos ha permitido identificar otros compuestos candidatos susceptibles de ser evaluados en ensayos clínicos para pacientes con GB. Sin embargo, el desarrollo de estas estrategias debe tener en cuenta la capacidad de acceso de estas drogas a la lesión cerebral: polaridad, tamaño de la molécula y lipofilidad. Así, aunque un área de enfermedad bulky ha alterado la barrera hematoencefálica (BHE), como se puede evidenciar por la presencia de captación de contraste incrementada en estudios de neuroimágen, los márgenes infiltrativos incluyen células tumorales que han migrado lejos del epicentro de la masa tumoral y pueden alojarse en zonas de BHE intactas (44).

Debido a la alta frecuencia de amplificación de EGFR (40%) y la mutación en EGFRvIII (25%), diversos ensayos clínicos han evaluado anticuerpos monoclonales o moléculas contra tirosina kinasa dirigidos contra el receptor EGFR(45-48). Solomon et al. publicaron un ensayo clínico en pacientes con astrocitoma anaplásico y glioblastomas tratados con radiación +/- nimotuzumab que resultó en un incremento en la sobrevida con el anticuerpo monoclonal (49). Recientemente se ha publicado el caso de un paciente afecto de glioblastoma recurrente con amplificación de MET (presente en el 1% de los casos) que obtuvo una reducción del 40% del volumen de la lesión tras tratamiento con crizotinib, un anticuerpo monoclonal dirigido contra esta molécula (50).

DESARROLLO DE BIOMARCADORES PRONÓSTICOS

Los estudios de marcadores predictivos de respuesta a agentes alquilantes han identificado la enzima O6- metilguanina-ADN metiltransferasa (MGMT) como la responsable de la eliminación de grupos alquilo de la posición O6 de la guanina (efecto de los agentes alquilantes). El promotor MGMT carece de elementos regulatorios conocidos como caja TATA o caja CAT, y contiene una isla CpG rica en 97 dinucleotidos CG o sitios CpG, localizados en la región 5 de MGMT. Los sitios CpG metilados se unen a proteínas específicas y este complejo causa estructuras de cromatina alteradas y pérdida de transcripción (silenciamiento de MGMT). El promotor MGMT esta metilado en alrededor del 45% de los glioblastomas y es más común en los secundarios. El estudio de elección para evaluar la metilación de promotor MGMT es mediante PCR-específico de metilación (MSP) o mediante pirosecuenciación. No se recomienda evaluar la expresión de proteína MGMT con técnicas immunohistoquímicas (36,51-53).

En la evaluación de la metilación del promoto MGMT, el DNA de los tumores de glioblastoma se somete a reacción de bisulfito, mediante la cual los residuos de citosinas no metilados son convertidos a uracilos tras el tratamiento. Como control positivo de la metilación se emplean linfocitos sanos obtenidos de sangre periférica metilados in vitro con el enzima CpG Metiltransferasa (M.SssI). Para el análisis de MSP, las PCR se realizan de forma independiente para los alelos metilados y los no metilados con cebadores específicos para el promotor MGMT no metilado (um_MGMT: F: TTTGTGTTTTGATGTTTGTAGGTTTTTGT; R:AACTCCACACTCTTCCAAAAACAAAACA) y el promotor MGMT metilado (m_MGMT: F: TTTCGACGTTCTAGGTTTTCGC; R: GCACTCTTCCGAAAACGAAACG) y en condiciones variables para las temperaturas de anillamiento (55-66 ºC). Los productos de la reacción son analizados por electroforesis en geles de agarosa (2-3%).

La metilación del promotor MGMT se asocia a una mayor supervivencia al margen del tratamiento escogido. También se asocia a una mayor respuesta a temozolomida (54,55), a radioterapia (56) y a la combinación de ambos. Así, en el trabajo previamente descrito de Stupp et al. se realizó un subestudio que evaluaba el estado de metilación del promotor MGMT en 206 tumores, encontrando que la presencia de metilación se asociaba a una mayor supervivencia global. Además, solamente en aquellos enfermos con presencia de metilación se comprobó un incremento en el tiempo libre de progresión con el uso del tratamiento concurrente de radioterapia/ temozolomida (p<0,001). Finalmente, el recientemente publicado ensayo clínico fase III NOA-08 evaluó el uso de temozolomida monoterapia o radiación en 373 pacientes mayores de 65 años no encontrando diferencias en la supervivencia. La prueba de la metilación del promotor MGMT tumoral realizada en 209 pacientes permitió identificar aquellos con un mayor aumento del tiempo libre de progresión de la enfermedad en el grupo que recibió temozolomida, pero no logró predecir el pronóstico entre los que recibieron radiación (57).

Algunos estudios evalúan otros marcadores pronósticos o de respuesta al tratamiento, entre ellos la presencia de un componente oligodendroglial. Los tumores oligodendrogliales han sido previamente asociados a la pérdida del material genético de los brazos cromosómicos 1p y 19q que aparentemente producen la pérdida de los genes supresores tumorales CIC (cromosoma 19q) y FUBP-1 (cromosoma 1p). Esta codelesion otorgaría un mejor pronóstico y podría estar asociado con una mayor respuesta a agentes alquilantes en astrocitoma anaplásico y oligodendroglioma anaplásico. Este componente está presente en alrededor de 10% de los GB (aparentemente dentro del subtipo proneural y clásico), sin embargo, no se ha demostrado su valor pronostico en GB (58). Así mismo, dada la alta especificidad de este patrón de codelesión puede ayudar a diferenciar el oligodendrogliomas de alto grado de GB de la variante de células pequeñas.

Recientemente se han detectado mutaciones del gen IDH1 ubicado en el cromosoma 2q, en gliomas difusos de grados II y III: Las mutaciones de IDH1 son heterocigotas, de origen somático y en la gran mayoría de los casos afectan al codón 132. Estan presentes en el 50-80% de los astrocitomas y GB secundarios, mientras que son muy infrecuentes en los GB primarios. El desarrollo de un anticuerpo muy específico de la mutación IDH1 R132H (clon H09) permite una determinación fácil y rutinaria de la mutación en tejido parafinado. Varias series grandes estudiaron el estado de la mutación IDH1 en astrocitomas grado III y GB y encontraron que la presencia o no de la mutación tiene valor pronóstico. Asi, los tumores se clasifican de mejor a peor pronóstico de la siguiente forma: astrocitoma grado III con mutación; GB con mutación; astrocitoma grado III sin mutación y GB sin mutación (6,23,25-27).

De esta forma, concluimos en la necesidad de continuar con un manejo multidisciplinario de esta entidad que reta el espíritu de los pacientes y de los galenos comprometidos en su manejo.

Fuentes de financiamiento: autofinanciado.

Conflictos de interés: los autores declaran no tener conflictos de interés.

Contribuciones de autoría. CAC, SCZ, PGC participaron en la concepción y diseño del artículo; CAC, SCZ, PGC participó en el Análisis e interpretación de datos; CAC, SCZ, PGC y MCG participaron en la redacción del artículo; EOP, PDR, HHY, LOM participaron en la revisión crítica del artículo; CAC, SCZ, EOP, LOM realizaron la aprobación de su versión final.

 

Referencias Bibliográficas

1. Louis DN, Ohgaki H, Wiestler OD, Cavenee WK, Burger PC, Jouvet A, et al. The 2007 WHO classification of tumours of the central nervous system. Acta Neuropathol.  2007  Aug;114(2):97- 109.

2. Central Brain Tumor Registry of the United States. CBTRUS Statistical report: Primary Brain and Central Nervous System Tumors Diagnosed in the Unites States in 2004-2007 [Internet]. CBTRUS; 2011 [citado el 9 de setiembre de 2014] Disponible en: http://www.cbtrus.org/2011-NPCRSEER/WEB-0407-Report-3-3-2011.pdf

3. Liu W, Zhang S, Zhang L, Cui Q, Wang J, Gui T, et al. A prognostic analysis of pediatrics central nervous system small cell tumors: evaluation of EGFR family gene amplification and overexpression. Diagn Pathol. 2014 Jul 1;9:132.

4. Karsy M, Gelbman M, Shah P, Balumbu O, Moy F, Arslan E. Established and emerging variants of glioblastoma multiforme: review of morphological and molecular features. Folia Neuropathol. 2012;50(4):301-21.

5. Ohgaki H, Kleihues P. Genetic pathways to primary and secondary glioblastoma. Am J Pathol. 2007 May;170(5):1445-53.

6. Ortega-Aznar A, Jimenez-Leon P, Martinez E, Romero-Vidal FJ. [Clinico-pathological and molecular aspects of diagnostic and prognostic value in gliomas]. Rev Neurol. 2013 Feb 1;56(3):161-70. [Article in Spanish]

7. International Agency for Research on Cancer. GLOBOCAN 2012: Estimated cancer Incidence And Mortality Worldwide in 2012 [Internet]. Lyon: IARC; c2015 [citado el 9 de setiembre de 2014] Disponible en: http://globocan.iarc.fr/Default.aspx 

8. Dubrow R, Darefsky AS. Demographic variation in incidence of adult glioma by subtype, United States, 1992-2007. BMC Cancer. 2011 Jul 29;11:325.

9. Mitchell DA, Xie W, Schmittling R, Learn C, Friedman A, McLendon RE, et al. Sensitive detection of human cytomegalovirus in tumors and peripheral blood of patients diagnosed with glioblastoma. Neuro Oncol. 2008 Feb;10(1):10-8.

10. Moss AR. Occupational exposure and brain tumors. J Toxicol Environ Health. 1985;16(5):703-11.

11. Navas-Acién A, Pollán M, Gustavsson P, Plato N. Occupation, exposure to chemicals and risk of gliomas and meningiomas in Sweden. Am J Ind Med. 2002 Sep;42(3):214-27.

12. Cocco P, Dosemeci M, Heineman EF. Brain cancer and occupational exposure to lead. J Occup Environ Med.  1998 Nov;40(11):937-42.

13. Siemiatycki J, Richardson L, Straif K, Latreille B, Lakhani R, Campbell S, et al. Listing occupational carcinogens. Environ Health Perspect.  2004 Nov;112(15):1447-59.

14. McKean-Cowdin R, Preston-Martin S, Pogoda JM, Holly EA, Mueller BA, Davis RL. Parental occupation and childhood brain tumors: astroglial and primitive neuroectodermal tumors. J Occup Environ Med.  1998 Apr;40(4):332-40.

15. Cordier S, Monfort C, Filippini G, Preston-Martin S, Lubin F, Mueller BA, et al. Parental exposure to polycyclic aromatic hydrocarbons and the risk of childhood brain tumors: The SEARCH International Childhood Brain Tumor Study. Am J Epidemiol.  2004 Jun 15;159(12):1109-16.

16. Cook A, Woodward A, Pearce N, Marshall C. Cellular telephone use and time trends for brain, head and neck tumours. N Z Med J.  2003 Jun 6;116(1175):U457.

17. Inskip PD, Tarone RE, Hatch EE, Wilcosky TC, Shapiro WR, Selker RG, et al. Cellular-telephone use and brain tumors. N Engl J Med. 2001 Jan 11;344(2):79-86.

18. Hardell L, Carlberg M, Hansson Mild K. Use of mobile phones and cordless phones is associated with increased risk for glioma and acoustic neuroma. Pathophysiology.  2013 Apr;20(2):85- 110.

19. The Cancer Genome Atlas Research Network. Comprehensive genomic characterization defines human glioblastoma genes and core pathways. Nature. 2008 Oct 23;455(7216):1061-8.

20. The Cancer Genome Atlas [internet]. Genomic Understanding of Glioblastoma Expanded [Internet]. Bethesda, MD: TCGA; 2013 [citado el 9 de septiembre de 2014]. Disponible en: http://cancergenome.nih.gov/newsevents/newsannouncements/GBM_Expanded_news_release_2013 

21. Ruano Y, Mollejo M, Ribalta T, Fiano C, Camacho FI, Gómez E, et al. Identification of novel candidate target genes in amplicons of Glioblastoma multiforme tumors detected by expression and CGH microarray profiling. Mol Cancer.  2006 Sep 26;5:39.

22. Rao SK, Edwards J, Joshi AD, Siu IM, Riggins GJ. A survey of glioblastoma genomic amplifications and deletions. J Neurooncol. 2010 Jan;96(2):169-79.

23. Parsons DW, Jones S, Zhang X, Lin JC, Leary RJ, Angenendt P, et al. An integrated genomic analysis of human glioblastoma multiforme. Science. 2008 Sep 26;321(5897):1807-12.

24. Riemenschneider MJ, Jeuken JW, Wesseling P, Reifenberger G. Molecular diagnostics of gliomas: state of the art. Acta Neuropathol.  2010 Nov;120(5):567-84.

25. Ohno M, Narita Y, Miyakita Y, Matsushita Y, Yoshida A, Fukushima S, et al. Secondary glioblastomas with IDH1/2 mutations have longer glioma history from preceding lower-grade gliomas. Brain Tumor Pathol.  2013 Oct;30(4):224-32.

26. Dunn GP, Andronesi OC, Cahill DP. From genomics to the clinic: biological and translational insights of mutant IDH1/2 in glioma. Neurosurg Focus. 2013 Feb;34(2):E2.

27. Yang H, Ye D, Guan KL, Xiong Y. IDH1 and IDH2 mutations in tumorigenesis: mechanistic insights and clinical perspectives. Clin Cancer Res. 2012 Oct 15;18(20):5562-71.

28. Phillips HS, Kharbanda S, Chen R, Forrest WF, Soriano RH, Wu TD, et al. Molecular subclasses of high-grade glioma predict prognosis, delineate a pattern of disease progression, and resemble stages in neurogenesis. Cancer Cell. 2006 Mar;9(3):157-73.

29. Verhaak RG, Hoadley KA, Purdom E, Wang V, Qi Y, Wilkerson MD, et al. Integrated genomic analysis identifies clinically relevant subtypes of glioblastoma characterized by abnormalities in PDGFRA, IDH1, EGFR, and NF1. Cancer Cell.  2010 Jan 19;17(1):98-110.

30. Snuderl M, Fazlollahi L, Le LP, Nitta M, Zhelyazkova BH, Davidson CJ, et al. Mosaic amplification of multiple receptor tyrosine kinase genes in glioblastoma. Cancer Cell.  2011 Dec 13;20(6):810-7.

31. Szerlip NJ, Pedraza A, Chakravarty D, Azim M, McGuire J, Fang Y, et al. Intratumoral heterogeneity of receptor tyrosine kinases EGFR and PDGFRA amplification in glioblastoma defines subpopulations with distinct growth factor response. Proc Natl Acad Sci U S A. 2012 Feb 21;109(8):3041-6.

32. Brennan CW, Verhaak RG, McKenna A, Campos B, Noushmehr H, Salama SR, et al. The somatic genomic landscape of glioblastoma. Cell. 2013 Oct 10;155(2):462-77.

33. Sturm D, Witt H, Hovestadt V, Khuong-Quang DA, Jones DT, Konermann C, et al. Hotspot mutations in H3F3A and IDH1 define distinct epigenetic and biological subgroups of glioblastoma. Cancer Cell.  2012 Oct 16;22(4):425-37.

34. Noushmehr H, Weisenberger DJ, Diefes K, Phillips HS, Pujara K, Berman BP, et al. Identification of a CpG island methylator phenotype that defines a distinct subgroup of glioma. Cancer Cell. 2010 May 18;17(5):510- 22.

35. Popova SN, Bergqvist M, Dimberg A, Edqvist PH, Ekman S, Hesselager G, et al. Subtyping of gliomas of various WHO grades by the application of immunohistochemistry. Histopathology. 2014 Feb;64(3):365-79.

36. Stupp R, Hegi ME, Mason WP, Van den Bent MJ, Taphoorn MJ, Janzer RC, et al. Effects of radiotherapy with concomitant and adjuvant temozolomide versus radiotherapy alone on survival in glioblastoma in a randomised phase III study: 5-year analysis of the EORTC-NCIC trial. Lancet Oncol. 2009 May;10(5):459-66.

37. Westphal M, Ram Z, Riddle V, Hilt D, Bortey E. Gliadel wafer in initial surgery for malignant glioma: longterm follow-up of a multicenter controlled trial. Acta Neurochir (Wien). 2006 Mar;148(3):269-75.

38. Friedman HS, Prados MD, Wen PY, Mikkelsen T, Schiff D, Abrey LE, et al. Bevacizumab alone and in combination with irinotecan in recurrent glioblastoma. J Clin Oncol.  2009 Oct 1;27(28):4733-40.

39. Vredenburgh JJ, Desjardins A, Herndon JE 2nd, Dowell JM, Reardon DA, Quinn JA, et al. Phase II trial of bevacizumab and irinotecan in recurrent malignant glioma. Clin Cancer Res.  2007 Feb 15;13(4):1253-9.

40. Kreisl TN, Kim L, Moore K, Duic P, Royce C, Stroud I, et al. Phase II trial of single-agent bevacizumab followed by bevacizumab plus irinotecan at tumor progression in recurrent glioblastoma. J Clin Oncol. 2009 Feb 10;27(5):740-5.

41. Chinot OL, Wick W, Mason W, Henriksson R, Saran F, Nishikawa R, et al. Bevacizumab plus radiotherapytemozolomide for newly diagnosed glioblastoma. N Engl J Med. 2014 Feb 20;370(8):709-22.

42. Gilbert MR, Dignam JJ, Armstrong TS, Wefel JS, Blumenthal DT, Vogelbaum MA, et al. A randomized trial of bevacizumab for newly diagnosed glioblastoma. N Engl J Med. 2014 Feb 20;370(8):699-708.

43. Hofland KF, Hansen S, Sorensen M, Engelholm S, Schultz HP, Muhic A, et al. Neoadjuvant bevacizumab and irinotecan versus bevacizumab and temozolomide followed by concomitant chemoradiotherapy in newly diagnosed glioblastoma multiforme: A randomized phase II study. Acta Oncol.  2014 Jul;53(7):939-44.

44. Huse JT, Holland E, DeAngelis LM. Glioblastoma: molecular analysis and clinical implications. Annu Rev Med. 2013;64:59-70.

45. Combs SE, Heeger S, Haselmann R, Edler L, Debus J, Schulz-Ertner D. Treatment of primary glioblastoma multiforme with cetuximab, radiotherapy and temozolomide (GERT)--phase I/II trial: study protocol. BMC Cancer.  2006 May 18;6:133.

46. Ramos TC, Figueredo J, Catala M, Gonzalez S, Selva JC, Cruz TM, et al. Treatment of high-grade glioma patients with the humanized antiepidermal growth factor receptor (EGFR) antibody h-R3: report from a phase I/II trial. Cancer Biol Ther. 2006 Apr;5(4):375-9.

47. Karpel-Massler G, Schmidt U, Unterberg A, Halatsch ME. Therapeutic inhibition of the epidermal growth factor receptor in high-grade gliomas: where do we stand? Mol Cancer Res. 2009 Jul;7(7):1000-12.

48. Krakstad C, Chekenya M. Survival signalling and apoptosis resistance in glioblastomas: opportunities for targeted therapeutics. Mol Cancer. 2010 Jun 1;9:135.

49. Solomon MT, Selva JC, Figueredo J, Vaquer J, Toledo C, Quintanal N, et al. Radiotherapy plus nimotuzumab or placebo in the treatment of high grade glioma patients: results from a randomized, double blind trial. BMC Cancer. 2013 Jun 19;13:299.

50. Chi AS, Batchelor TT, Kwak EL, Clark JW, Wang DL, Wilner KD, et al. Rapid radiographic and clinical improvement after treatment of a MET-amplified recurrent glioblastoma with a mesenchymal-epithelial transition inhibitor. J Clin Oncol. 2012 Jan 20;30(3):e30-3.

51. Rodriguez FJ, Thibodeau SN, Jenkins RB, Schowalter KV, Caron BL, O’Neill B P, et al. MGMT immunohistochemical expression and promoter methylation in human glioblastoma. Appl Immunohistochem Mol Morphol. 2008 Jan;16(1):59-65.

52. Esteller M, Garcia-Foncillas J, Andion E, Goodman SN, Hidalgo OF, Vanaclocha V, et al. Inactivation of the DNA-repair gene MGMT and the clinical response of gliomas to alkylating agents. N Engl J Med. 2000 Nov 9;343(19):1350-4.

53. Bady P, Sciuscio D, Diserens AC, Bloch J, van den Bent MJ, Marosi C, et al. MGMT methylation analysis of glioblastoma on the Infinium methylation BeadChip identifies two distinct CpG regions associated with gene silencing and outcome, yielding a prediction model for comparisons across datasets, tumor grades, and CIMP-status. Acta Neuropathol. 2012 Oct;124(4):547-60.

54. Hegi ME, Diserens AC, Godard S, Dietrich PY, Regli L, Ostermann S, et al. Clinical trial substantiates the predictive value of O-6-methylguanine-DNA methyltransferase promoter methylation in glioblastoma patients treated with temozolomide. Clin Cancer Res.  2004 Mar 15;10(6):1871-4.

55. Hegi ME, Diserens AC, Gorlia T, Hamou MF, de Tribolet N, Weller M, et al. MGMT gene silencing and benefit from temozolomide in glioblastoma. N Engl J Med. 2005 Mar 10;352(10):997- 1003.

56. Olson RA, Brastianos PK, Palma DA. Prognostic and predictive value of epigenetic silencing of MGMT in patients with high grade gliomas: a systematic review and meta-analysis. J Neurooncol. 2011 Nov;105(2):325-35.

57. Wick W, Platten M, Meisner C, Felsberg J, Tabatabai G, Simon M, et al. Temozolomide chemotherapy alone versus radiotherapy alone for malignant astrocytoma in the elderly: the NOA-08 randomised, phase 3 trial. Lancet Oncol. 2012 Jul;13(7):707-15.

58. Hegi ME, Janzer RC, Lambiv WL, Gorlia T, Kouwenhoven MC, Hartmann C, et al. Presence of an oligodendroglioma-like component in newly diagnosed glioblastoma identifies a pathogenetically heterogeneous subgroup and lacks prognostic value: central pathology review of the EORTC_26981/NCIC_ CE.3 trial. Acta Neuropathol.  2012 Jun;123(6):841-52.

 

Correspondencia: Carlos A. Castañeda

Dirección: Av. Angamos Este 2520 - Surquillo, Lima, Perú

Teléfono: 992157220

Correo electrónico: carloscastanedaaltamirano@yahoo.com

 

Recibido: 07-10-14

Aprobado: 18-03-15

Enlaces refback

  • No hay ningún enlace refback.




Copyright (c) 2015 Revista Peruana de Medicina Experimental y Salud Pública


Copyright  2019 Instituto Nacional de Salud. Lima, Perú. Todos los derechos reservados
ISSN electrónica 1726-4642 - ISSN impresa 1726-4634
El contenido de este sitio es para todos los interesados en ciencias de la salud
Licencia Creative Commons