Expresión diferencial de micro-ARN circulantes en pacientes con tuberculosis activa y latente

ARTÍCULO ORIGINAL

 

Expresión diferencial de micro-ARN circulantes en pacientes con tuberculosis activa y latente

Differential expression of circulating micro-RNAs in patients with active tuberculosis and infected with latent tuberculosis

 

José Yareta  1,2, Biólogo
Marco Galarza  1,
Biólogo
Silvia Capristano 1
, tecnólogo médico con especialidad en Laboratorio Clínico
Oscar Pellón  1,
biólogo molecular, PhD en Biología Celular y Molecular del Cáncer
César Sánchez  1
, médico cirujano; Maestría en Ciencias
Jorge Ballon 2
, médico cirujano; Maestría en Ciencias
Heinner Guio  1,
médico cirujano; PhD en Ciencias Médicas

1 Laboratorio de Referencia Nacional de Biotecnología y Biología Molecular, Instituto Nacional de Salud, Lima, Perú.
2
Departamento Académico de Biología, Universidad Nacional de San Agustín de Arequipa, Arequipa, Perú.

 


RESUMEN

Objetivo: El objetivo del estudio fue analizar la expresión diferencial de miR-21, miR-29a, miR-99b y miR-155 en muestras de suero de pacientes con tuberculosis (TB) latente y TB activa respecto a contro­les sanos.

Materiales y métodos: Se utilizaron 28 muestras de suero (nueve con TB activa, diez con TB latente y nueve controles sanos) para el análisis de expresión génica mediante RT-qPCR con Primers y sondas TaqMan. Se calculó la expresión diferencial por el método de Livak utilizando un gen norma­lizador (RNU-48).4

Resultados: Se halló una sobreexpresión de miR-155 en personas con tuberculosis latente, respecto a los controles sanos (0,63 vs. 0,01; valor de p=0,032).

Conclusión: El miR-155 podría ser considerado un biomarcador para diferenciar TB latente de enfermedad activa. Se requieren estudios con mayores tamaños muestrales para corroborar nuestros hallazgos.

Palabras clave: Tuberculosis Latente; Tuberculosis; MicroARNs; Perú (fuente: DeCS BIREME).

 


ABSTRACT

Objectives: To analyze the differential expression of miR-21, miR-29a, miR-99b and miR-155 in serum samples from patients with latent tuberculosis (TB) and active TB compared to healthy controls.

Mate­rials and Methods: We used 28 serum samples (9 with active TB, 10 with latent TB and 9 healthy con­trols) for the analysis of gene expression by RT-qPCR with Primers and TaqMan probes. The differential expression was calculated by the Livak method using a normalizing gene (RNU-48).

Results: Overex­pression of miR-155 was found in people with latent tuberculosis, compared to healthy controls (0.63 vs. 0.01; p value = 0.032).

Conclusion: The miR-155 could be considered a biomarker to differentiate latent TB from active disease. Studies with larger sample sizes are required to corroborate the findings.

Keywords: Latent Tuberculosis; Tuberculosis; microRNAs; Peru (source: MeSH NLM).

 


INTRODUCCIÓN

La tuberculosis (TB) es una de las diez enfermedades con más muertes en el mundo y es cau­sada por el bacilo Mycobacterium tuberculosis (Mtb). En 2017, la Organización Mundial de la Salud (OMS) reportó que 31 120 casos de TB fueron notificados en Perú (1, 2). Asimismo, 1,7 mil millones de personas presentan TB latente, además según Houben y Dodd del 20 % a 30 % de la población peruana tiene TB latente (3).

La búsqueda de nuevos biomarcadores, derivados del patógeno o del hospedero, se está enfocando en conceptos de comunicación celular, representadas por las vesículas extracelu­lares llamadas exosomas. El estudio de micro-ARN circulantes contenidos en estos exosomas está proponiendo nuevos métodos de diagnóstico en distintas enfermedades, incluyendo en­fermedades infecciosas (4), por lo que pueden ser detectadas fácilmente en los distintos tipos de biofluídos del cuerpo humano.

 

MENSAJES CLAVE

 

Motivación para realizar el estudio: La búsqueda de un biomarcador que permita diagnosticar tuberculosis latente de manera rápida y confiable en el Perú.

Principales hallazgos: Se encontró un micro-ARN (miR-155) que estaría sobre expresado en individuos con diagnóstico de tuberculosis latente.

Implicancias: Al tener un alto porcentaje de población peruana infectada con tuberculosis latente, un biomarcador adecuado nos ayudará a diag­nosticar de manera oportuna la infección tuberculosa antes que se desarrolle la enfermedad activa y dirigir el tratamiento o profilaxis para quienes realmente lo necesitan.

 

El análisis de los cambios dinámicos del cargo de exosomas, a nivel de micro-ARN y proteínas en específico, nos ofrece la posibilidad de investigar la activación de vías de señalización celular e inmunológicas en tiempo real, para validar biomarcadores que correspondan a estadios sintomáticos y asintomáticos (5).

En la actualidad los métodos de diagnóstico de tuberculosis solo detectan la enfermedad activa, por lo que no existen bio­marcadores que diferencien TB latente y TB activa para un diagnóstico más específico, es por ello que desde hace algunos años se viene investigando la diferencia de moléculas producidas por el hospedero (micro-ARN) en el contexto de una enfermedad infecciosa versus personas sanas como control, este proceso se denomina «expresión diferencial» y es evaluado por PCR en tiempo real, considerando un gen normalizador o gen de referencia (6, 7). Estas moléculas son micro-ARN con 18 a 24 nucleóti­dos, no codificantes, endógenamente expresados y altamente conservados, que regulan la expresión postranscripcional de los genes mediante la sub/sobre expresión de ARNs en una amplia gama de organismos tanto en contextos fisiológicos normales como en contextos de enfermedades. 

La desregulación de micro-ARN es variable en las enfermedades infecciosas y según población estudiada. En este sentido, el estudio de estos micro-ARN en TB ha sido evaluado en población europea y asiática principalmente, donde se caracteri­zaron diversos micro-ARN expresados diferencialmente entre las patologías (8, 9). Los avances tecnológicos han generado una multitud de plataformas para la creación de perfiles de micro-ARN y una comprensión de las fortalezas y las dificultades de los diferentes enfoques puede ayudar a su uso efectivo (10).

En el presente estudio, se evaluó la expresión diferencial de los micro-ARN miR-21, miR-29a, miR-99b y miR-155 a partir de muestras de suero de pacientes, con la finalidad de poder encontrar un perfil diferente en TB latente en comparación con TB activa con respecto a controles sanos.

 

MATERIALES Y MÉTODOS

Muestras clínicas y extracción de ARN

Las muestras clínicas fueron constituidas por 28 muestras de suero de pacientes con diagnóstico TB activa (n=9), personas con TB latente (n=10) y controles sanos (n=9) (Tabla 1). Las muestras estuvieron almacenadas en crioviales de 2 ml en la congeladora a–80°C (Thermo Fisher Scientific Inc.) de la seroteca del área de Inmunología del Laboratorio de Referencia Nacional de Biotecnología y Bio­logía Molecular del Centro Nacional de Salud Pública del Instituto Nacional de Salud.

 

Tabla 1. Características clínicas y de exámenes auxiliares en pacientes con TB latente, TB activa y controles sanos.

PPD: Derivado Proteico Purificado de Mycobacterium tuberculosis; TB: Tuberculosis; mm: milímetros; (+) resultado positivo de la prueba.

 

Las muestras fueron recolectadas durante el periodo comprendido entre 2012 y 2016, y forman parte de un estudio aproba­do por el Comité de Ética en Investigación del Instituto Nacional de Salud, «Estudio de las características inmunológicas de la tuberculosis latente en la población peruana, año 2012-2014» (según código OGIIT OI 01-072-10). Cada participante del estu­dio firmó un consentimiento informado previamente aprobado por el Comité de Ética del Instituto Nacional de Salud del Perú.

La extracción de ARN a partir de los sueros seleccionados se realizó según las recomendaciones del fabricante con el uso del kit miRNeasy (Qiagen). La concentración de ARN total fue cuantificado usando un equipo Nanodrop 8000 (Thermo Fish­er). El ARN extraído se almacenó a -20 °C en agua ultra pura libre de ARNasas (11) y procesado inmediatamente por retrotran­scripción a ADN complementario dentro de las 72 horas.

Selección de micro-ARN para validación por PCR en tiempo real

Se realizó una búsqueda de los micro-ARN expresados diferencialmente en publicaciones previas que incluían diferentes pobla­ciones, encontrándose principalmente trabajos en población europea y asiática (8, 9, 12-14). Los criterios de selección de micro-ARN incluyeron: a) micro-ARN expresados en pacientes con TB, b) micro-ARN diferencialmente expresados en suero por PCR en tiempo real y c) micro-ARN sobreexpresados en pacientes con TB mediante las plataformas Microarray y Next generation sequen­cing. Teniendo en cuenta estos criterios, de un grupo de micro-ARN relacionados con TB se seleccionaron cuatro micro-ARN: miR-21, miR-29a, miR-99b y miR-155 como posibles biomarcadores para un diagnóstico diferencial entre TB latente y TB activa (9, 10, 13-16) en muestras de la población peruana.

PCR en tiempo real y análisis de expresión diferencial de micro-ARN

Los primers ya diseñado fueron los siguientes: hsa-miR-21 (MI0000077:UAGCUUAUCAGACUGAUGUUGA), hsa-miR-29a (MI0000087: UAGCACCAUCUGAAAUCGGUUA), hsa-miR-99b (MI0000746: UGAGGUAGGAGGUUGUAUAGUU) y hsa­miR-155 (MI0000681: UUAAUGCUAAUCGUGAUAGGGGU) (Applied Biosystem) de la base de datos miRbase (http://www.mirbase.org/) (17). La amplificación de los micro-ARN se realizó en dos pasos: inicialmente se hizo una retrotranscripción para obtener el ADN complementario, usando el kit TaqMan MicroRNA Reverse Transcription (Applied Biosystem), seguido de la amplificación por PCR en tiempo real usando el kit TaqMan Universal PCR Master Mix II (Applied Biosystem). Los volúmenes y concentraciones de muestras fueron según recomendaciones del fabricante (18). La retrotranscripción se realizó en el termocicla­dor Veriti (Applied Biosystem) bajo las siguientes condiciones: 16 °C por 30 minutos, 42 °C por 30 minutos y 85 °C por 5 minutos. La posterior amplificación se realizó en el termociclador Rotor Gene Q (Qiagen) siguiendo las condiciones: 95 °C por 10 minutos, 45 ciclos de 95°C por 15 segundos y 60°C por 60 segundos. Cada muestra  se corrió por duplicado y el termociclador nos consideró un Ct promedio de ambas corridas por muestra y gen de interés evaluado. Se utilizó el ARN nuclear RNU48 como gen de referen­cia (11, 19) para normalizar la expresión de los genes en estudio.

El análisis de expresión diferencial se calculó mediante el método de Livak, que utiliza los valores de Ct (valor umbral para discriminar entre negativo y positivo, máximo Ct considerado fue de 35) (19) de las muestras enfermas y muestras sanas para finalmente normalizarse con el gen de referencia (RNU48). La mediana de los valores de Ct se usó para calcular la cantidad relativa mediante el método comparativo ddCt. Los valores de ddCt se utilizaron para hallar el nivel de expresión diferencial o cuantificación relativa normalizada mediante el método de Livak o 2 (-ddCt), donde dCt muestras enfermas = (Ct micro-ARN de interés - Ct RNU48), dCt muestras sanas = (Ct micro-ARN de interésCt RNU48) y el ddCt = (dCt muestras enfermas - dCt muestras sanas) y la cuantificación relativa normalizada o expresión diferencial es igual a 2-ddCt o Fold Change (FC, que es el cambio en la expresión respecto al grupo control o muestras sanas) (7).

Análisis estadístico

Los niveles de expresión de micro-ARN se analizaron mediante la prueba no paramétrica Kruskal-Wallis con la cual se hicieron múltiples comparaciones entre los grupos TB latente, TB activo y controles sanos y luego se realizó la prueba de Mann-Whit­ney. Se utilizó el paquete estadístico Prism 6 (GraphPad Software, Inc, CA, USA).

 

RESULTADOS

Cuantificación relativa de micro-ARN por PCR en tiempo real

Los resultados de cuantificación relativa por PCR en tiempo real muestran valores de Ct diferentes en cada curva de fluo­rescencia para miR-21, miR-29a, miR-99b y miR-155 respecto al normalizador RNU48, los cuales nos dieron valores de Ct menores a 35, estos Ct se usaron para hallar el ddCt y el nivel de expresión relativa normalizado.

Al analizar los datos de Ct obtenidos por PCR en tiempo real, se encontró que los cuatro micro-ARN seleccionados es­tuvieron expresados diferencialmente (pero sin llegar a una diferencia estadísticamente significativa al comparar los grupos mediante la prueba no paramétrica Kruskal-Wallis y Mann-Whitney en los pacientes con TB activa y pacientes con TB latente en comparación con los controles sanos).

Normalización y análisis de datos

La cuantificación relativa normalizada o expresión génica para miR-21, miR-29a, miR-99b y miR-155 en muestras de suero, según el método de Livak, está representado por la cantidad de veces más expresado en muestras de TB activa y TB latente frente al grupo control. La cuantificación relativa normalizada (RQn) de estos micro-ARN entre TB latente y TB activa está representada por la mediana relativa entre ambas patologías (Tabla 2).

 

Tabla 2. Análisis de expresión diferencial normalizada de miR-21, miR-29a, miR-99b y miR-155 entre pacientes con TB latente y pacientes con TB activa frente a controles sanos.

L1-L10: Pacientes con diagnóstico clínico de tuberculosis latente; A1- A9: Pacientes con diagnóstico clínico de tuberculosis activa; ddCt*: método de Livak o expresión (fold change); TB: Tuberculosis.

 

No se encontró diferencias estadísticas en la expresión del gen miR-99b entre los pacientes con TB activa y TB latente (Figuras 1 y 2).

 

Se muestra la distribución de las expresiones desde el mínimo al máximo nivel de expresión en cada grupo y las diferencias en las medianas para cada grupo de genes.

Figura 1. Cuantificación relativa normalizada en diez pacientes con TB latente y nueve pacientes con TB activa frente a los controles sanos. Análisis realizado por el método de Livak.

 

Figura 2. Expresión diferencial (medianas) de micro-ARN entre TB latente y TB activa.

 

DISCUSIÓN

Desde hace algunos años, los análisis transcriptómicos están brindando información acerca de cómo se están expresando los genes y como estos son regulados por ARN pequeños, dentro de este grupo los micro-ARN. Actualmente, estas pequeñas mo­léculas están siendo utilizadas como potenciales componentes de vacunas, biomarcadores de diagnóstico temprano en cáncer y predictores de enfermedades metabólicas (20, 21). Asimismo, la expresión de otros grupos de ARNs pequeños, de los cuales no se conocía muy claramente su función, hoy en día están siendo considerados como biomarcadores de enfermedad (22).

Los hallazgos relacionados a la desregulación de estos micro-ARN son variados. Wang et al. demostró que miR-21 se expresa de modo diferencial entre pacientes con TB activa e pacientes con TB latente, mostrando así que se pudiera utilizar este mi-cro-ARN como biomarcador para diferenciar a las personas con TB latente de TB activa (2,99 FC) (23). En nuestra investigación se encontró una sobreexpresión de miR-21 en muestras de TB activa (2.07 FC), lo que es congruente con el trabajo de Wu et al. quienes señalaron que miR-21 podría estar involucrado en la regulación de la respuesta antimicobacterial. Ellos reportan que miR-21 podría ser inducido después de la vacunación con BCG por la activación de NF-kB, y que miR-21 podría suprimir la producción de IL-12 (24), y que podría indicar que en pacientes con TB latente miR-21 esté también sobre expresado; tal como lo reportó Kleinsteuber et al. en una investigación donde compararon la expresión de miR-21 en donantes sanos (PPD negativo), individuos con TB latente y pacientes con TB activa; encontrando mayor expresión de miR-21 en pacientes con TB latente (0,0438 FC) que en presencia de PPD (0,0393 FC) y pacientes con TB activa (0,0121 FC) (9). Sin embargo, según nuestros re­sultados el perfil de expresión de miR-21 en muestras de TB latente es mayor respecto al control, pero en menor expresión en presencia de TB activa; por lo que miR-21 podría ser una efectiva estrategia que usa Mtb frente a la respuesta inmune del hospe­dero para evadir a las células de defensa y desarrollar la TB activa (14), pero al comparar la expresión entre TB latente y TB activa, no hay diferencias significativas, por lo que no sería un biomarcador para diferenciar ambas patologías.

Por otra parte, Wu et al. reportaron que el perfil de expresión de miR-155 (3,7 FC) en presencia de PPD (proteína deriva­da de Mtb para detectar TB latente por una respuesta inmune antígeno-anticuerpo) podría ser un potencial marcador para el diagnóstico de TB en presencia de antígenos específicos a Mtb (25). Sin embargo, nuestros resultados muestran mayor expresión de miR-155 en tuberculosis latente (0,63 FC) que en TB activa (0,01 FC) respecto a las muestras control, miR-155 podría ser un posible biomarcador de TB latente. Este dato no es totalmente opuesto al de J. Wu et al., ya que ellos también encontraron una sobreexpresión de miR-155 en presencia de PPD. Esta proteína de Mtb activa al sistema inmune temprano, expresando efectores inmunológicos contra la TB latente tal como lo demuestra Fu et al. en un estudio reciente donde expresa que miR-155 regula la respuesta inmune adaptativa (13).

El sistema inmunológico al regular la invasión de Mtb no causa sintomatología clínica, por lo tanto la infección se vuelve latente en el hospedero, notándose así una sobreexpresión de miR-155 en muestras de suero tal como lo predijeron Kumar et al., donde miR­155 es sobreexpresado en macrófagos infectados con Mtb como una respuesta inmune temprana contra la infección de tuberculosis (26); lo que ratificaría nuestros resultados de una sobreexpresión de miR-155 en muestras de suero con TB latente (0,63 FC) al compa­rarlos con TB activa (0,01 FC). Asimismo, Wang et al. reportaron expresión diferencial de miR-155 entre TB activa y TB latente, ya que miR-155 está subexpresado en muestras de TB activa (0,51 FC) y sobreexpresado en muestras de TB latente (1,97 FC) (23). Por su parte, lado Zhou et al. describen que miR-155 está subexpresado en muestras con TB activa de niños (27); lo que permitiría usar miR-155 como biomarcador de TB latente en las diferentes etapas de la vida. En otro estudio, Wagh et al. resaltó la subexpresión de miR-155 en muestras de TB-MDR, respecto al control y pacientes con TB en tratamiento, lo cual demuestra que la virulencia de Mtb se puede diagnosticar por la subexpresión de miR-155 (28). Por lo que los resultados de nuestra investigación sugieren que miR-155 podría ser un efectivo biomarcador para el diagnóstico de TB latente y marcar la progresión de la enfermedad en sus diferentes estadios.

El nivel de expresión de miR-29a hallado en nuestro estudio es elevado en muestras de TB activa y TB latente respecto al control, pero fue más sobreexpresado en muestras de TB latente que en las de TB activa. Este resultado coincide con los estudios de Fu et al., quienes hallaron sobreexpresión de miR-29a (11,9 FC), que podría discriminar a pacientes con TB de controles sanos (13, 29). Pero en nuestro estudio además rescatamos una sobreexpresión de miR-29a (1,50 FC) en TB latente respecto a la expresión en muestras de TB activa (1,05 FC), pero sin encontrar diferencias significativas en la expresión entre TB latente y TB activa.

Se debe mencionar que una de las limitaciones para el presente estudio fue el número total de participantes, esto debido a que se planteó como un estudio exploratorio, por lo que los resultados obtenidos deben validarse con un número mayor de participantes.

Por otro lado, actualmente se vienen realizando estudios a nivel de proteínas exosomales que podrán ser usados en diag­nóstico de rutina de algunos cánceres (30) y consideramos que el siguiente paso será con los micro-ARN para diagnóstico de enfermedades infecciosas.

En conclusión, el análisis de los niveles de expresión diferencial de micro-ARN en suero de pacientes con TB activa y TB latente es interesante para el diagnóstico de esta patología. Basándonos en los resultados de este estudio, podemos concluir que la sobreexpresión significativa de miR-155 en muestras con TB latente podría ser un posible biomarcador para la diferencia­ción entre tuberculosis latente y activa. Sin embargo, se requieren estudios con mayor número de participantes para corroborar nuestros hallazgos.

 

REFERENCIAS BIBLIOGRÁFICAS

1. GBD Tuberculosis Collaborators. Global, regional, and national burden of tuberculosis, 1990-2016: results from the Global Burden of Diseases, Injuries, and Risk Factors 2016 Study. Lancet Infect Dis. 2018;18(12):1329-1349. doi:10.1016/S1473-3099(18)30625-X

2. World Health Organization. Global tuberculosis report 2018 [Internet]. Geneva: WHO; 2018 [citado el 14 de septiembre de 2019]. Disponible en: https://www.who.int/tb/publications/global_report/gtbr2018_main_text_28Feb2019.pdf?ua=1.

3. Houben RM, Dodd PJ. The Global Burden of Latent Tuberculosis Infection: A Re-estimation Using Mathematical Modelling. PLoS Med. 2016;13(10):e1002152. doi: 10.1371/journal.pmed.1002152.

4. Zhang W, Jiang X, Bao J, Wang Y, Liu H, Tang L. Exosomes in pathogen infections: a bridge to deliver molecules and link functions. Front Immu­nol. 2018;9:90. doi: 10.3389/fimmu.2018.00090.

5. Smith VL, Cheng Y, Bryant BR, Schorey JS. Exosomes function in antigen presentation during an in vivo Mycobacterium tuberculosis infection. Sci Rep. 2017;7:43578. doi: 10.1038/srep43578.

6. Chen C, Ridzon DA, Broomer AJ, Zhou Z, Lee DH, Nguyen JT, et al. Real-time quantification of micro-RNAs by stem-loop RT-PCR. Nucleic Acids Res. 2005;33(20):e179. doi: 10.1093/nar/gni178.

7. Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc. 2008;3(6):1101-8. doi: 10.1038/nprot.2008.73.

8. Correia CN, Nalpas NC, McLoughlin KE, Browne JA, Gordon SV, MacHugh DE, et al. Circulating microRNAs as Potential Biomarkers of Infectious Disease. Front Immunol. 2017;8:118. doi: 10.3389/fimmu.2017.00118.

9. Kleinsteuber K, Heesch K, Schattling S, Kohns M, Sander-Julch C, Walzl G, et al. Decreased expression of miR-21, miR-26a, miR-29a, and miR-142-3p in CD4(+) T cells and peripheral blood from tuberculosis patients. PloS One. 2013;8(4):e61609. doi: 10.1371/journal.pone.0061609.

10. Pritchard CC, Cheng HH, Tewari M. MicroRNA profiling: approaches and considerations. Nat Rev Genet. 2012;13(5):358-69. doi: 10.1038/nrg3198.

11. Yareta Yareta JL. Validación de un perfil de microARNs para el diagnóstico diferencial de tuberculosis latente y tuberculosis activa 2018 [Tesis]. Arequipa: Universidad Nacional San Agustín de Arequipa; 2018. Disponible en: http://repositorio.unsa.edu.pe/bitstream/handle/UNSA/4795/BIyayajl.pdf?sequen­ce=1&isAllowed=y.

12. Abd-El-Fattah AA, Sadik NA, Shaker OG, Aboulftouh ML. Differential microRNAs expression in serum of patients with lung cancer, pulmonary tuberculosis, and pneumonia. Cell Biochem Biophys. 2013;67(3):875-84. doi: 10.1007/s12013-013-9575-y.

13. Fu Y, Yi Z, Wu X, Li J, Xu F. Circulating microRNAs in patients with active pulmonary tuberculosis. J Clin Microbiol. 2011;49(12):4246-51. doi: 10.1128/ JCM.05459-11.

14. Harapan H, Fitra F, Ichsan I, Mulyadi M, Miotto P, Hasan NA, et al. The roles of microRNAs on tuberculosis infection: meaning or myth?. Tuberculosis (Edinb). 2013;93(6):596-605. doi: 10.1016/j.tube.2013.08.004.

15. Huang J, Jiao J, Xu W, Zhao H, Zhang C, Shi Y, et al. MiR-155 is upregulated in patients with active tuberculosis and inhibits apoptosis of monocytes by targeting FOXO3. Mol Med Rep. 2015;12(5):7102-8. doi: 10.3892/mmr.2015.4250.

16. Mashima R. Physiological roles of miR-155. Immunology. 2015;145(3):323-33. doi: 10.1111/imm.12468.

17. Kozomara A, Griffiths-Jones S. miRBase: annotating high confidence microRNAs using deep sequencing data. Nucleic Acids Res. 2014;42(Database is­sue):D68-73. doi: 10.1093/nar/gkt1181.

18. Biosystems A. TaqMan® Universal Master Mix II. Protocol: Life Technologies Corporation [Internet] thermoFisher scientific; 2010 [citado el 20 de septiembre del 2019]. Disponible en: https://assets.thermofisher.com/TFSAssets/LSG/manuals/cms_069368.pdf.

19. Miotto P, Mwangoka G, Valente IC, Norbis L, Sotgiu G, Bosu R, et al. miRNA signatures in sera of patients with active pulmonary tuberculosis. PloS One. 2013;8(11):e80149. doi: 10.1371/journal.pone.0080149.

20. Chakraborty C, George Priya Doss C, Bandyopadhyay S. miRNAs in insulin resistance and diabetes-associated pancreatic cancer: the ‘minute and miraclemolecule moving as a monitor in thegenomic galaxy’. Curr Drug Targets. 2013;14(10):1110-7. doi: 10.2174/13894501113149990182.

21. Munagala R, Aqil F, Gupta RC. Exosomal miRNAs as biomarkers of recurrent lung cancer. Tumour biol. 2016;37(8):10703-14. doi: 10.1007/s13277-016-4939-8.

22. Qian Z, Liu H, Li M, Shi J, Li N, Zhang Y, et al. Potential Diagnostic Power of Blood Circular RNA Expression in Active Pulmonary Tuberculosis. EBioMe­dicine. 2018;27:18-26. Doi: 10.1016/j.ebiom.2017.12.007.

23. Wang C, Yang S, Sun G, Tang X, Lu S, Neyrolles O, et al. Comparative miRNA expression profiles in individuals with latent and active tuberculosis. PloS One. 2011;6(10):e25832. Doi: 10.1371/journal.pone.0025832.

24. Wu Z, Lu H, Sheng J, Li L. Inductive microRNA-21 impairs anti-mycobacterial responses by targeting IL-12 and Bcl-2. FEBS letters. 2012;586(16):2459-67. doi: 10.1016/j.febslet.2012.06.004.

25. Wu J, Lu C, Diao N, Zhang S, Wang S, Wang F, et al. Analysis of microRNA expression profiling identifies miR-155 and miR-155* as potential diagnostic markers for active tuberculosis: a preliminary study. Hum immunol. 2012;73(1):31-7. doi: 10.1016/j.humimm.2011.10.003.

26. Kumar R, Halder P, Sahu SK, Kumar M, Kumari M, Jana K, et al. Identification of a novel role of ESAT-6-dependent miR-155 induction during infection of macrophages with Mycobacterium tuberculosis. Cell Microbiol. 2012;14(10):1620-31. doi: 10.1111/j.1462-5822.2012.01827.x.

27. Zhou M, Yu G, Yang X, Zhu C, Zhang Z, Zhan X. Circulating microRNAs as biomarkers for the early diagnosis of childhood tuberculosis infection. Mol Med Rep. 2016;13(6):4620-6. doi: 10.3892/mmr.2016.5097.

28. Wagh V, Urhekar A, Modi D. Levels of microRNA miR-16 and miR-155 are altered in serum of patients with tuberculosis and associate with responses to therapy. Tuberculosis (Edinb). 2017;102:24-30. doi: 10.1016/j.tube.2016.10.007.

29. Fu Y, Yi Z, Li J, Li R. Deregulated microRNAs in CD4+ T cells from individuals with latent tuberculosis versus active tuberculosis. J Cell Mol Med. 2014;18(3):503-13. doi: 10.1111/jcmm.12205.

30. Zhang W, Ou X, Wu X. Proteomics profiling of plasma exosomes in epithelial ovarian cancer: A potential role in the coagulation cascade, diagnosis and prognosis. Int J Oncol. 2019;54(5):1719-33. doi: 10.3892/ijo.2019.4742.

 

Fuentes de financiamiento: Instituto Nacional de Salud del Perú.

Citar como: Yareta J, Galarza M, Capristano S, Pellón O, Ballon J, Guio H. Expresión diferencial de micro-ARN circulantes en pacientes con tuberculosis activa y latente. Rev Peru Med Exp Salud Publica. 2020;37(1): 51-6. Doi: https://doi.org/10.17843/rpmesp.2020.371.4468.

Correspondencia: Heinner Guio Chunga; Av. Defensores del Morro 2268, Chorrillos, Lima; heinnerguio@gmail.com

Conflictos de interés: Todos los autores declaran que no tienen conflicto de interés alguno.

Recibido:
16/04/2019

Aprobado:
29/01/2020

En línea:
23/03/2020

Enlaces refback

  • No hay ningún enlace refback.




Copyright (c) 2020 Revista Peruana de Medicina Experimental y Salud Pública


Copyright  2020 Instituto Nacional de Salud. Lima, Perú. Todos los derechos reservados
ISSN electrónica 1726-4642 - ISSN impresa 1726-4634
El contenido de este sitio es para todos los interesados en ciencias de la salud
Licencia Creative Commons