Caracterización microbiológica y molecular de la resistencia antimicrobiana de Escherichia coli uropatógenas de hospitales públicos peruanos

10.17843/rpmesp.2021.381.6182
ORIGINAL BREVE

 

Caracterización microbiológica y molecular de la resistencia antimicrobiana de Escherichia coli uropatógenas de hospitales públicos peruanos

Microbiological and molecular characterization of antimicrobial resistance in uropathogenic Escherichia coli from peruvian public hospitals

 

Pool Marcos-Carbajal 1,2, Biólogo; magíster en Biología Molecular
Guillermo Salvatierra 2, médico veterinario; magíster en Biología Molecular
José Yareta 1, Biólogo  
Jimena Pino 3, Biólogo
Nancy Vásquez 3, Biólogo
Pilar Diaz 4, técnico en laboratorio
Isabel Martínez 5, técnico en laboratorio
Percy Asmat 6, Biólogo
Carlos Peralta 7, Biólogo
Caridad Huamani 7, Biólogo
Alexander Briones 8, tecnólogo médico
Manuel Ruiz 9, Biólogo
Nicomedes Laura 10, técnico en laboratorio
Álvaro Luque 11, Biólogo
Leonel Arapa 12, Biólogo
Pablo Tsukayama 2, Biólogo; doctor en Microbiología Molecular

1 Laboratorio de Investigación en Biología Molecular, EP Medicina Humana, Universidad Peruana Unión, Lima, Perú.
2 Laboratorio de Genómica Microbiana, Universidad Peruana Cayetano Heredia, Lima, Perú.
3 Laboratorio de Microbiología, Hospital Antonio Lorena, Cuzco, Perú.
4 Servicio de Microbiología, Laboratorio de Referencia Regional Salud Pública San Martín, Tarapoto, Perú.
5 Servicio de Microbiología, Laboratorio de Referencia Regional de Salud Pública Tumbes, Tumbes, Perú.
6 Servicio de Microbiología, Laboratorio de Referencia Regional Salud Pública, La Libertad, Trujillo, Perú.
7 Área de Microbiología, IPRESS Jorge Chávez, Madre de Dios, Perú.
8 Servicio de Microbiología, Hospital Regional de Loreto, Iquitos, Perú.
9  Área de Microbiología, Clínica Adventista Ana Stahl, Iquitos, Perú.
10 Servicio de Microbiología, Laboratorio de Referencia Regional de Salud Pública Huancavelica, Huancavelica, Perú.
11 Área de Microbiología, Clínica Americana Juliaca, Juliaca, Perú.
12 Laboratorio de Microbiología, Hospital Carlos Monge Medrano, Juliaca, Perú.

 


RESUMEN

Se caracterizó la resistencia antimicrobiana de 70 aislados de Escherichia coli obtenidos de pacientes con infección del tracto urinario (ITU) provenientes de ocho hospitales públicos en el Perú. Los perfiles de resistencia fueron identificados mediante el uso del sistema automatizado MicroScan®. Se utilizó una reacción en cadena de la polimerasa convencional para la detección de los genes blaTEM, blaCTX-M, blaSHV y blaPER. El 65,7% (46/70) de los aislados presentó un fenotipo multidrogorresistente y el 55,7% (39/70) fue identificado como productores de betalactamasas de espectro extendido. Se detectaron altos niveles de resistencia para ampicilina (77,1%), ciprofloxacina (74,3%), trimetoprim/sulfametoxazol (62,9%), cefepime (57,1%) y cefuroxima (57,1%). El gen blaTEM fue el más frecuente con un 31,4%, seguido por blaCTX-M (18,6%) y blaSHV (2,9%). Los resultados evidencian altos niveles de resistencia a antimicrobianos de importancia clínica en aislados de E. coli de pacientes con ITU en el Perú.

Palabras clave: Escherichia coli; Farmacorresistencia Bacteriana; Resistencia betalactámica; Enfermedades Urológicas; Perú (fuente: DeCS BIREME).

 


ABSTRACT

We characterized the antimicrobial resistance of 70 Escherichia coli isolates obtained from patients with a urinary tract infection (UTI) from 8 public hospitals in Peru. Resistance profiles were identified using the automated MicroScan® system. A standard polymerase chain reaction was used for the detection of the blaTEM, blaCTX-M, blaSHV and blaPER genes. The 65.7% (46/70) of the isolates presented a multidrug-resistant phenotype and 55.7% (39/70) were extended-spectrum beta-lactamases producers. High levels of resistance were detected for ampicillin (77,1%), ciprofloxacin (74,3%), trimethoprim/sulfamethoxazole (62,9%), cefepime (57,1%), and cefuroxime (57,1%). The blaTEM gene was the most frequent (31,4%), followed by blaCTX-M (18,6%) and blaSHV (2,9%) genes. These results show high resistance levels to antimicrobials of clinical use in E. coli isolates from hospital UTI patients in Peru.

Keywords: Escherichia coli, Drug Resistance, beta-Lactam Resistance, Urologic Diseases, Peru (source: MeSH NLM).

 


INTRODUCCIÓN

Las infecciones del tracto urinario (ITU) tienen una alta incidencia en todo el mundo, y ocasionan elevados costos de tratamiento para los sistemas de salud (1). Escherichia coli es el agente etiológico encontrado con mayor frecuencia en las ITU y el tratamiento se basa en antimicrobianos. Sin embargo, la falta de regulación de estos tratamientos favoreció la aparición de cepas multidrogorresistentes (MDR) en todo el mundo (2) y la emergencia de cepas de E. coli productoras de betalactamasas de espectro extendido (BLEE) con la capacidad de hidrolizar penicilinas, cefalosporinas y monobactams. Los genes que codifican la producción de BLEE se encuentran frecuentemente en plásmidos y usualmente van acompañados de otros genes de resistencia a cefalosporinas, sulfonamidas, fluoroquinolonas y aminoglucósidos (3). Existen diversos genes codificantes para BLEE, siendo más frecuentes los de las familias TEM, SHV y CTX-M (4,5). Más de 400 tipos de estas enzimas han sido reportadas y las CTX-M son las de mayor frecuencia en todo el mundo (6).

En el Perú, la detección de resistencia antimicrobiana en bacterias causantes de ITU no está incluida en el sistema de vigilancia epidemiológica y no se cuenta con datos actualizados (7). Conocer los niveles de resistencia y genes asociados a la producción de BLEE en aislados de E. coli de ITU permitirá establecer terapias empíricas efectivas y programas de control. Por ello, el objetivo del estudio fue caracterizar mediante pruebas fenotípicas y moleculares la resistencia antimicrobiana y prevalencia de BLEE en aislados de E. coli de pacientes con ITU provenientes de ocho hospitales públicos de diferentes departamentos del Perú.

MENSAJES CLAVE

Motivación para realizar el estudio: Es importante actualizar los datos sobre niveles y patrones de resistencia antimicrobiana en Escherichia coli uropatógenas. Determinar cuáles son los patrones de resistencia permiten orientar una terapéutica adecuada para este tipo de infecciones.

Principales hallazgos: Se detectaron altos niveles de resistencia para ampicilina, ciprofloxacina, trimetoprim/sulfametoxazol, cefepime y cefuroxima. El 55,7% de los aislados fue identificado como productor de betalactamasas de espectro extendido (BLEE) con la presencia de los genes blaTEM, blaCTX-M y blaSHV.

Implicancias: La alta frecuencia de cepas de E. coli multidrogoresistentes productoras de BLEE es alarmante y debe generar conciencia sobre el uso adecuado de antimicrobianos en el tratamiento de infecciones del tracto urinario.

 

EL ESTUDIO

Se realizó un estudio descriptivo, basado en la obtención de aislados bacterianos de ocho hospitales públicos localizados en los departamentos de Cusco, Huancavelica, La Libertad, Loreto, Madre de Dios, Puno, San Martín y Tumbes. Se utilizó un total de 70 aislados de E. coli obtenidos de pacientes ambulatorios con diagnóstico clínico compatible con ITU recolectados durante el 2018.

Los aislados fueron caracterizados en el Laboratorio de Investigación en Biología Molecular de la Universidad Peruana Unión. La confirmación de especie y determinación de perfiles de resistencia se llevó a cabo mediante el uso del sistema automatizado MicroScan® (AutoScan-4) y el uso de paneles para gramnegativos (Dade MicroScan®) siguiendo indicaciones del fabricante. Se incluyeron 15 antimicrobianos correspondientes a diferentes familias: ampicilina (AMP), ampicilina con sulbactam (AMP/SUL), amoxicilina con ácido clavulánico (AMC), piperacilina con tazobactam (PIP/TZ), aztreonam (ATM), cefepime (FEP), cefuroxima (CFX), ceftazidima (CAZ), cefotaxima (FOX), tobramicina (TOB), gentamicina (GEN), ciprofloxacina (CIP), trimetoprim/sulfametoxazol (SXT), colistina (COL) y tigeciclina (TIG). Adicionalmente, se detectó la presencia de E. coli productores de betalactamasas de espectro extendido (BLEE). Los resultados fueron interpretados según recomendaciones del Clinical and Laboratory Standards Institute (CLSI, sus siglas en inglés) (8).

La extracción de ADN se realizó por medio del kit innuPREP siguiendo instrucciones del fabricante (Analytik Jena, Alemania). Para la identificación de genes, se utilizó una reacción en cadena de la polimerasa (PCR) convencional diseñada para cada gen blaCTX-M (9), blaTEM (10), blaSHV (11) y blaPER (12). Las secuencias de cebadores utilizados son detalladas en la Tabla 1.

 

Tabla 1. Cebadores utilizados para la amplificación de genes.

Genes

Amplicón (pb)

Cebador

Secuencias

Referencia

blaCTX-M

544

CTX/F

TTTGCGATGTGCAGTACCAGTAA

9

CTX/R

CGATATCGTTGGTGGTGCCAT

blaTEM

504

TEM/F

TTGGGTGCACGAGTGGGTTA

10

TEM/R

TAATTGTTGCCGGGAAGCTA

blaSHV

865

SHV/F

ATGCGTTATATTCGCCTGTG

11

SHV/R

GTTAGCGTTGCCAGTGCTCG

blaPER

927

PER/F

ATGAATGTCATCACAAAATG

12

PER/R

TCAATCCGGACTCACT

 

La multidrogorresistencia fue definida según la detección de un fenotipo resistente para al menos un antimicrobiano en tres o más clases. La proporción de aislados resistentes fue estratificada según sexo del paciente. El análisis bivariado se desarrolló mediante el uso de la prueba exacta de Fisher con un nivel de confianza del 95%. El manejo de datos se realizó con el uso del paquete estadístico Stata 16 (StataCorp, College Station, Texas, EE. UU.).

El estudio fue evaluado y aprobado por el Comité de Ética de la Universidad Peruana Unión (N2019-CEUPeU-0001) y por la Dirección Universitaria de Investigación, Ciencia y Tecnología de la Universidad Peruana Cayetano Heredia.

HALLAZGOS

Se obtuvieron 70 aislados de Escherichia coli provenientes de pacientes ambulatorios con diagnóstico compatible con una infección del tracto urinario (UTI) provenientes de hospitales públicos en Huancavelica (n=15), Loreto (n=14), Tumbes (n=13), Madre de Dios (n=12), La Libertad (n=8), Puno (n=4), Cusco (n=3) y San Martín (n=1). La media de edad fue 38,8 años y el 80% (n=56) fueron pacientes femeninos. El 65,7% de los aislados (46/70) presentó un fenotipo multidrogorresistente (MDR), siendo más frecuente en pacientes de sexo masculino (78,6%, 11/14) en comparación a los femeninos (62,5%, 35/56). El 55,7% (39/70) de los aislados fueron identificados como productores de betalactamasas de espectro extendido (BLEE), con una mayor frecuencia en pacientes de sexo masculino (64,3%, 9/14) en comparación con los femeninos (53,6%, 30/56). Sin embargo, estas diferencias no fueron estadísticamente significativas (p>0,05). El 92,3% (36/39) de los aislados identificados como productores de BLEE, presentó un fenotipo MDR incluyendo resistencia a aminoglucósidos, fluoroquinolonas, betalactámicos y sulfonamidas.

Se detectaron altos porcentajes de resistencia para ampicilina (77,1%), ciprofloxacina (74,3%), trimetoprim/sulfametoxazol (62,9%), cefepime (57,1%), cefuroxima (57,1%) y ampicilina con sulbactam (40%). Los aislados de pacientes de sexo masculino presentaron los niveles de resistencia más altos (Figura 1). Sin embargo, solo los aislados provenientes de pacientes femeninos presentaron resistencia a ceftazidima (10,7%, n=6), aztreonam (3,6%, n=2), cefotaxima (3,6%, n=2), tigeciclina (1,8%, n=1). Estas diferencias no fueron estadísticamente significativas (p>0,05).  No se detectaron aislados resistentes a amikacina, ertapenem, imipenem y meropenem.

  

AMP: ampicilina, CIP: ciprofloxacina, SXT: trimetoprim/sulfametoxazol, FEP: cefepime, CFX: cefuroxima, AMP/SUL: ampicilina con sulbactam, TOB: tobramicina,
GEN: gentamicina, AMC: amoxicilina con ácido clavulánico, COL: colistina, PIP/TZ: piperacilina con tazobactam, CAZ: ceftazidima, ATM: aztreonam, FOX: cefotaxima,
TIG: tigeciclina.

Figura 1. Perfiles de resistencia de Escherichia coli según sexo del paciente.

 

La familia de genes blaTEM fue detectada por PCR en un 31,4% (22/70), seguido por blaCTX-M (18,6%, n=13) y blaSHV (2,9%, n=2), tanto en aislados productores y no productores de BLEE. Del total de aislados BLEE, el 56,4% (22/39) fue positivo para al menos uno de los genes evaluados. El gen blaCTX-M fue el más común (28,2%, 11/39), de los cuales solo un aislado lo presentó en combinación con el gen blaSHV. El 25,6% (10/39) de los aislados productores de BLEE presentaron el gen blaTEM. No se evidenció la presencia conjunta de los genes blaCTX-M y blaTEM. Del total de aislados no productores de BLEE, el 54,8% (17/31) no presentó ninguno de los genes evaluados. El 38% (12/31) presentó el gen blaTEM y solo el 6,5% (n=2) el gen blaCTX-M. Del total de aislados productores y no productores de BLEE, no se detectó la presencia del gen blaPER (Tabla 2).

 

Tabla 2. Detección de genes relacionados a la producción de betalactamasas de espectro extendido (BLEE) en Escherichia coli uropatógenas.

Fenotipo

n

blaCTX-M

blaSHV

blaTEM

blaPER

BLEE
(n=39)

17

-

-

-

-

10

-

-

+

-

10

+

-

-

-

1

-

+

-

-

1

+

+

-

-

BLEE

17

-

-

-

-

negativo

12

-

-

+

-

(n=31)

2

+

-

-

-

+/-: presencia/ausencia del gen según resultados de la reacción en cadena de polimerasa.

 

DISCUSIÓN

Los aislados de E. coli de pacientes con ITU presentaron altos niveles de resistencia a antimicrobianos de importancia clínica. Más del 50% de los aislados fue clasificado como MDR y productor de BLEE. Las resistencias más frecuentes fueron para ampicilina, ciprofloxacina y trimetoprim/sulfametoxazol, antimicrobianos usados con frecuencia para el tratamiento de ITU (13). Además, se encontraron aislados resistentes a colistina, una droga de último recurso utilizada en ITU complicada causada por bacterias MDR (14). No se detectaron aislados resistentes a imipenem, meropenem y ertapenem. Sin embargo, la detección de aislados de E. coli uropatógenos productores de BLEE representa un riesgo potencial de desarrollo de resistencia, debido a su capacidad de transportar genes de resistencia a otros antimicrobianos (15).

Los aislados de pacientes de sexo masculino exhibieron mayores niveles de resistencia para ampicilina, ciprofloxacina, trimetoprim/sulfametoxazol, cefepime, cefuroxima, ampicilina con sulbactam, tobramicina, gentamicina, amoxicilina con ácido clavulánico, colistina y piperacilina con tazobactam. Las diferencias encontradas según el sexo de los pacientes no fueron significativas, por lo que no podemos evidenciar que ser un paciente de sexo masculino sería un indicador para la selección empírica de antimicrobianos para el tratamiento de ITUs. Sin embargo, nuestros resultados muestran una alta prevalencia de E. coli resistente a diversos antimicrobianos de uso frecuente en estas infecciones. Se debe considerar un mayor cuidado en la selección de esquemas terapéuticos por parte de los médicos tratantes para evitar así una presión selectiva que conlleve a la emergencia de cepas MDR.

La familia de genes blaTEM fue la más frecuente, seguida por blaCTX-M y blaSHV. Estos resultados contrastan con los encontrados por otros autores, siendo el gen blaCTX-M el más frecuente en pacientes con ITU en el Perú (16–18). Un total de 17 aislados productores de BLEE fueron negativos para todos los genes evaluados. Inclusive, se detectó la presencia de los genes blaCTX-M (n=2) y blaTEM (n=12) en los aislados identificados como no productores de BLEE. Las diferencias observadas en la detección de aislados BLEE por métodos fenotípicos y genotípicos reflejan la baja sensibilidad que posee el método fenotípico y la posible influencia de factores externos en la presentación de resistencia. Posiblemente, muchos aislados no produjeron BLEE a niveles detectables por el método fenotípico, lo que podría explicar la presencia de aislados BLEE negativos, pero con genes relacionados a la producción de esas enzimas. En contraste al método fenotípico, la detección de genes mediante la amplificación de PCR posee mejores niveles de especificidad y sensibilidad. Sin embargo, estos valores están estrechamente correlacionados a la calidad y diseño de cebadores. Inclusive, variantes de genes blaTEM o blaSHV no BLEE han sido descritas, por lo que métodos de secuenciamiento resultan esenciales para su identificación y caracterización (19).

En conclusión, los resultados evidencian altos niveles de resistencia en aislados de E. coli portadores de los genes blaTEM, blaCTX-M y blaSHV recuperados de pacientes ambulatorios con diagnóstico de ITU en distintas regiones del Perú. Los hospitales peruanos públicos realizan el monitoreo de la resistencia antimicrobiana utilizando principalmente métodos fenotípicos y en menor medida, métodos moleculares. Sin embargo, estas metodologías pueden no reflejar de manera correcta el estado de la resistencia antimicrobiana en este y otros tipos de infecciones. Por ello, resulta necesaria la implementación de métodos de última generación para la vigilancia genómica de la resistencia antimicrobiana en hospitales.

Los resultados presentados corresponden a una primera fase del estudio. Utilizaremos métodos de secuenciamiento del genoma completo y análisis bioinformático para el estudio de la resistencia antimicrobiana en estos aislados bacterianos. La información generada servirá como herramienta epidemiológica para determinar la distribución de los genes de resistencia y también como una guía para evaluar la tendencia y posibles cambios en los esquemas terapéuticos por parte de los médicos tratantes.

Agradecimientos:

A los docentes de la Escuela de Medicina Humana de la Universidad Peruana Unión (Salomón Huancahuire y Miguel Otiniano), al personal del Laboratorio de Genómica Microbiana de la Universidad Peruana Cayetano Heredia (Brenda Ayzanoa, Janet Huancachoque y Camila Castillo) y a Marco Galarza del Laboratorio de Biotecnología y Biología Molecular del Instituto Nacional de Salud por su apoyo en la recolección de aislados.

 

REFERENCIAS BIBLIOGRÁFICAS

1.Stamm WE, Norrby SR. Urinary tract infections: disease panorama and challenges. J Infect Dis. 2001;183 Suppl 1: S1-4. doi:10.1086/318850.

2. Pitout JD. Extraintestinal Pathogenic Escherichia coli: A Combination of Virulence with Antibiotic Resistance. Front Microbiol. 2012;3:9. doi: 10.3389/fmicb.2012.00009.

3. Lee SY, Kotapati S, Kuti JL, Nightingale CH, Nicolau DP. Impact of extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella species on clinical outcomes and hospital costs: a matched cohort study. Infect Control Hosp Epidemiol. 2006;27(11):1226-32. doi: 10.1086/507962.

4. D’Andrea MM, Arena F, Pallecchi L, Rossolini GM. CTX-M-type β-lactamases: a successful story of antibiotic resistance. Int J Med Microbiol. 2013;303(6-7):305-17. doi: 10.1016/j.ijmm.2013.02.008.

5. Pitout JD, Hossain A, Hanson ND. Phenotypic and molecular detection of CTX-M-beta-lactamases produced by Escherichia coli and Klebsiella spp. J Clin Microbiol. 2004;42(12):5715-21. doi: 10.1128/JCM.42.12.5715-5721.2004.

6. Woerther PL, Burdet C, Chachaty E, Andremont A. Trends in human fecal carriage of extended-spectrum β-lactamases in the community: toward the globalization of CTX-M. Clin Microbiol Rev. 2013;26(4):744-58. doi: 10.1128/CMR.00023-13.

7. Astete S, Madrid L, Fukuda F, Buckley A, Meritens D, Menchola JV. Sensibilidad antibiótica de los gérmenes causantes de infecciones urinarias en pacientes ambulatorios en el Hospital Nacional Arzobispo Loayza. Rev Soc Per Med Inter. 2004;17(1): 5-8.

8. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing [Internet]. 30th ed; 2020 [citado el 12 de febrero de 2020]; Disponible en:https://clsi.org/standards/products/microbiology/documents/m100/.

9. Edelstein M, Pimkin M, Palagin I, Edelstein I, Stratchounski L. Prevalence and molecular epidemiology of CTX-M extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae in Russian hospitals. Antimicrob Agents Chemother. 2003;47(12):3724-32. doi: 10.1128/aac.47.12.3724-3732.2003.

10. Arlet G, Philippon A. Construction by polymerase chain reaction and intragenic DNA probes for three main types of transferable Î2-lactamases (TEM, SHV, CARB). FEMS Microbiol Lett. 1991;68(1):125. doi:10.1111/j.1574-6968.1991.tb04833.x.

11. Essack SY, Hall LM, Pillay DG, McFadyen ML, Livermore DM. Complexity and diversity of Klebsiella pneumoniae strains with extended-spectrum beta-lactamases isolated in 1994 and 1996 at a teaching hospital in Durban, South Africa. Antimicrob Agents Chemother. 2001;45(1):88-95. doi: 10.1128/AAC.45.1.88-95.2001.

12. Kiratisin P, Apisarnthanarak A, Laesripa C, Saifon P. Molecular characterization and epidemiology of extended-spectrum-beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae isolates causing health care-associated infection in Thailand, where the CTX-M family is endemic. Antimicrob Agents Chemother. 2008;52(8):2818-24. doi: 10.1128/AAC.00171-08.

13. Huang ES, Stafford RS. National patterns in the treatment of urinary tract infections in women by ambulatory care physicians. Arch Intern Med. 2002;162(1):41-7. doi: 10.1001/archinte.162.1.41.

14. Cui P, Niu H, Shi W, Zhang S, Zhang H, Margolick J, et al. Disruption of Membrane by Colistin Kills Uropathogenic Escherichia coli Persisters and Enhances Killing of Other Antibiotics. Antimicrob Agents Chemother. 2016;60(11):6867-6871. doi: 10.1128/AAC.01481-16.

15. Carattoli A. Plasmids in Gram negatives: molecular typing of resistance plasmids. Int J Med Microbiol. 2011;301(8):654-8. doi: 10.1016/j.ijmm.2011.09.003.

16. Galván F, Agapito J, Bravo N, Lagos J, Tamariz J. Caracterización fenotípica y molecular de Escherichia coli productoras de β-Lactamasas de espectro extendido en pacientes ambulatorios de Lima, Perú. Rev Medica Hered. 2016;27:22. doi:10.20453/rmh.v27i1.2780.

17. Salles MJ, Zurita J, Mejía C, Villegas MV; Latin America Working Group on Bacterial Resistance. Resistant gram-negative infections in the outpatient setting in Latin America. Epidemiol Infect. 2013;141(12):2459-72. doi: 10.1017/S095026881300191X.

18. Miranda J, Pinto J, Faustino M, Sánchez-Jacinto B, Ramirez F. Antimicrobial resistance of uropathogens in older adults in a private clinic in Lima, Peru. Rev Peru Med Exp Salud Publica. 2019;36(1):87-92. doi: 10.17843/rpmesp.2019.361.3765.

19. Pitout JD, Laupland KB. Extended-spectrum beta-lactamase-producing Enterobacteriaceae: an emerging public-health concern. Lancet Infect Dis. 2008;8(3):159-66. doi: 10.1016/S1473-3099(08)70041-0.

 

Financiamiento: El trabajo fue posible gracias al apoyo proporcionado por la Escuela Profesional de Medicina Humana de la Facultad de Ciencias de la Salud de la Universidad Peruana Unión (Resolución No 0935-2018-UPEU-FCS-CF), Lima-Perú.

Citar como:Marcos-Carbajal P, Salvatierra G, Yareta J, Pino J, Vásquez N, Diaz P, et al. Caracterización microbiológica y molecular de la resistencia antimicrobiana de Escherichia coli uropatógenas de hospitales públicos peruanos. Rev Peru Med Exp Salud Publica. 2021;38(1):119-23. doi: https://doi.org/10.17843/rpmesp.2021.381.6182.

Correspondencia: Pool Marcos Carbajal; Mz. H Lote 79 Urb. San Antonio Carapongo, Lurigancho-Chosica, Perú; poolmarcoscarbajal@gmail.com

Contribuciones de autoría: PM y PT participaron en la concepción y diseño del estudio. PM, GS y PT realizaron el análisis e interpretación de datos. PM, JY, GS y PT realizaron la redacción y revisión crítica del artículo. JY, JP, NV, PD, IM, PA, CP, CH, AB, MR, NL, AL y LA brindaron información, recolección y procesamiento de las cepas. GS brindó asesoría estadística. Todos los autores aprobaron la versión final y son responsables de los contenidos del manuscrito.

Conflictos de interés: Los autores no tienen ningún conflicto de interés que declarar.

Recibido: 19/07/2020
Aprobado: 28/10/2020
En línea: 14/02/2021

Enlaces refback

  • No hay ningún enlace refback.




Copyright (c) 2021 Revista Peruana de Medicina Experimental y Salud Pública


Copyright  2021 Instituto Nacional de Salud. Lima, Perú. Todos los derechos reservados
ISSN electrónica 1726-4642 - ISSN impresa 1726-4634
El contenido de este sitio es para todos los interesados en ciencias de la salud
Licencia Creative Commons